Find research datasets worth reusing

opencc-by-4.0Mar 2024View details →

Qiime2 classifiers (rbcl, Mollusc 18s) for testing the validity of using eDNA for carbon origin analysis from sediment cores

Qiime2 formatted classifiers that were created for a Natural England funded project by researchers at the James Hutton Institute. The pilot project aims to test the validity of using eDNA for carbon origin analysis from sediment cores. These classifiers for the rbcl and 18 Mollusc genes were made using RESCRIPt and Qiime2.  The scripts used to created these classifiers are available at the James Hutton ICS GitHub <a href="https://github.com/HuttonICS/blue-carbon-db">blue-carbon-db</a> . The files are as follows: <a href="../api/records/10046481/draft/files/mollusc-espineira-classifier.qza/content" target="_blank" rel="noopener noreferrer">mollusc-espineira-classifier.qza</a> is a classifer built from ncbi 18s Mollusc sequences, trained on the primer set from Espiñeira et al (2009). <div>rbcl-vasselon-zimmerman-F3-R1-classifier.qza is a classifer built from ncbi rbcl sequences, trained on the F3 and R1 primer set fromVasselon et al (2017).</div>     Important: If you use these classifiers please be aware of the process used to create them and be sure to review the methods. These databases were created by downloading data from the NCBI in October 2023, sequence data available at the NCBI changes over time. To create the most up to date database a fresh download and re-evaluations of the databases would be preferable. All method and scripts can be found at <a href="https://github.com/HuttonICS/blue-carbon-db">blue-carbon-db </a> If you use these database please reference this repository along with RESCRIPt and Qiime2    Espiñeira, M., González-Lavín, N., Vieites, J. M. and Santaclara, F. J. 2009 Development of a method for the genetic identification of commercial bivalve species based on mitochondrial 18S rRNA sequences. J Agric Food Chem, 28, 495-502 https://doi.org/10.1021/jf802787d   Vasselon, V., Rimet, F., Tapolczai, K. and Bouchez, A. 2017. Assessing ecological status with diatoms DNA metabarcoding: Scaling-up on a WFD monitoring network (Mayotte island, France). Ecological Indicators, 82, 1-12 <a title="Persistent link using digital object identifier" href="https://doi.org/10.1016/j.ecolind.2017.06.024" target="_blank" rel="noreferrer noopener">https://doi.org/10.1016/j.ecolind.2017.06.024</a>

opencc-by-4.0Mar 2022View details →

EukRibo: a manually curated eukaryotic 18S rDNA reference database

EukRibo is a manually curated database of reference small-subunit ribosomal RNA gene (18S rDNA) sequences of eukaryotes, specifically aimed at taxonomic annotation of high-throughput metabarcoding datasets. Unlike other reference databases of ribosomal genes, it is not meant to exhaustively capture all publicly available 18S rDNA sequences from the INSDC repositories, but to represent a subset of highly trustable sequences covering the whole known diversity of eukaryotes, with a focus on protists, manually verified taxonomic identifications, and relatively low genetic redundancy. EukRibo is part of a suite of public resources generated by the UniEuk project (www.unieuk.org), which are all designed to follow a common taxonomic framework for maximal interoperability. The high level of taxonomic accuracy of EukRibo, together with a newly designed, phylogenetically-informed annotation approach, allow high confidence in the taxonomic annotation of environmental metabarcodes, as well as identification of new eukaryotic diversity at various taxonomic levels using a connected components approach. *   *   * Accompanying preprint available at <a href="https://doi.org/10.1101/2022.11.03.515105">https://doi.org/10.1101/2022.11.03.515105</a>. *   *   * EukRibo ReadMe file, versions 1 and 2 Each EukRibo release consists of 4 files: - a tsv table containing the taxonomic and other information about the 18S rDNA sequences included in the release - a fasta file containing the full sequences as retrieved from the INSDC repositories (NCBI, EMBL-EBI/ENA, DDBJ) - a fasta file containing the variable region V4 extracted from all these sequences (based on the fragment amplified with the Tara-Oceans V4 primers) - a fasta file containing the variable region V9 extracted from the subset of sequences where it is present (based on the fragment amplified with the Tara-Oceans V9 primers) The primary goal of EukRibo was to be used to annotate the EukBank meta-dataset of available V4 metabarcoding datasets, and therefore all sequences included in EukRibo contain the variable region V4. Only a subset of these sequences (about 75%) also contain the variable region V9; this is because many 18S rDNA sequences in the INSDC repositories stop before the V9 fragment. Sequences with slightly incomplete V4 or V9 fragments were kept if phylogenetically useful - i.e. if they are the only available representatives of a certain taxonomic lineage. V4    We allowed up to 50 missing positions in the relatively conserved area at the 5' end of the V4 fragment (for an average fragment length of about 380 bp); no sequence incomplete at the 3' end of the V4 fragment is included. V9    We allowed up to 30 missing positions in the relatively conserved area at the 3' end of the V9 fragment (for an average length of about 135 bp); no sequence incomplete at the 5' end of the V9 fragment is included. We allowed a higher proportion of missing positions for the V9 region because being more conservative would imply losing too many sequences, including entire taxonomic lineages. Version 1 of EukRibo This is the starting version of EukRibo that was used for the taxonomic annotation of the EukBank dataset, with taxonomy strings that were fixed as of October 2020. - Contains 46,345 sequences with a sufficiently complete V4 region; 46,299 with the actual complete V4 region and 46 (about 0.1%) with missing positions at the 5' end. - Of these, 34,438 also include a sufficiently complete V9 region; 23,226 with the actual complete V9 region and 11,206 (about 33%) with missing positions at the 3' end. Version 2 of EukRibo This is a version of EukRibo that was made taxonomically compatible with version 3 of the EukProt database (<a href="https://doi.org/10.1101/2020.06.30.180687">https://doi.org/10.1101/2020.06.30.180687</a>), with taxonomic revisions as of July 2022 as well as additional information on the included selection of sequences that was not provided in the tsv file of version 1. - Contains the exact same selection of sequences as in version 1, with the addition of genus Meteora, the last remaining known supergroup-level eukaryotic lineage for which an 18S rDNA was not previously available. (The Meteora sequence contains the full V4 fragment but does not include a sufficiently complete V9 fragment.) - Only 34,432 sequences with a sufficiently complete V9 region are now retained because of 6 previously unrecognised chimeric sequences where the V9 fragment does not originate from the same organism as the V4 fragment. Files in EukRibo version 1: 46345_EukRibo.tsv.gz 46345_EukRibo_full_seqs.fas.gz 46345_EukRibo_V4.fas.gz 34438_EukRibo_V9.fas.gz The tsv file contains 6 columns: gb_accession - INSDC accession number of the sequence supergroup, taxogroup1, taxogroup2 - binning of the taxa into strictly monophyletic clades of evolutionary and/or ecological significance UniEuk_taxonomy_string - full UniEuk-compatible taxonomic annotation of the sequence - an unlimited number of levels is allowed (going down to strain for isolated organisms or to clone for environmental sequences) - informal names are used for phylogenetically supported clades without formal name V9 - presence ('Y') or absence ('N') of a sufficiently complete V9 fragment in the sequence Files in EukRibo version 2: 46346_EukRibo-02.tsv.gz 46346_EukRibo-02_full_seqs.fas.gz 46346_EukRibo-02_V4.fas.gz 34432_EukRibo-02_V9.fas.gz The tsv file now contains 12 columns: gb_accession, supergroup, taxogroup1, taxogroup2, UniEuk_taxonomy_string     - same columns as in version 1 alternative_strain_names (new) - provides alternative strain/isolate names when known to help cross-linking genetic data coming from the same organism V4 (new) - indicates whether the V4 fragment is complete ('yes - complete') or missing positions at the 5' end ('yes - partial') V9 (emended content) - now contains more precise information than in version 1 about whether it is complete ('yes - complete'), missing positions at the 3' end ('yes - partial'), or was excluded, and the 6 possible reasons why ('no - missing', 'no - too incomplete', 'no - chimera', 'no - bad quality', 'no - deletion in V9', 'no - Ns in V9') EukProt_ID_same_strain (new) - accession of EukProt datasets from the same isolate EukProt_ID_different_strain (new) - accession of EukProt datasets from a different isolate of the same species columns_modified_since_previous_version (new) - lists all of the 6 pre-existing columns that have a modified content compared to version 1 remarks (new) - additional information such as presence of an intron in the V9 fragment, taxonomic identity of the two parts of chimeric sequences, or the presence of Ns or a deletion in the V4 or the V9 fragment (but insufficient to warrant exclusion)

opencc-by-4.0Aug 2021View details →

EAW FASTQ files for bioinformatic courses (18S rRNA genes, 2018)

Selection of 6 samples, with 6 Forward (R1) and 6 Reverse (R2) files, including primers. R1 and R2 reads are ca. 300 bp long, and were obtained from Illumina MiSeq technologies, at the FEM facility sequencing platform. The files refer to the18S rRNA gene reads obtained from the analyses carried out on the samples collected and filtered (SterivexTM 0.22 µm) in different areas and depths of Lake Garda on September, 2018 (see EAW_2018_FASTQ_18S_description.docx). Sampling and analyses were carried out in the framework of the project Eco-AlpsWater (ASP569), funded by the Interreg Alpine Space program. A bioinformatic protocol for analyzing these data using DADA2 is available in Zenodo: <pre>https://doi.org/10.5281/zenodo.5233527</pre> The corresponding 16S rRNA gene reads, obtained from the same eDNA extracts, are saved in <a href="https://doi.org/10.5281/zenodo.5215815">https://doi.org/10.5281/zenodo.5215815</a>

opencc-by-4.0Sep 2023View details →

18S rRNA V9 taxonomic classifier

18S metabarcoding databases and naive-bayes classifier specific to the V9 region. Built from the <a href="https://pr2-database.org/">PR2 v5.0.0 database</a> using Qiime2 (version 2021.2).Primers used:1391f: GTACACACCGCCCGTCEukBr: TGATCCTTCTGCAGGTTCACCTACFile Description pr2_seqs.qza     |.   Full length PR2 v5.0.0 sequencespr2_tax.qza        |    Taxa for PR2 v5.0.0 databaserefseqs_V9.qza. |   Sequences for 18S V9 (primers 1391f, EukBrr), extracted from PR2 SSU v5.0.0, generated by qiime2-2021.2 (forward compatible)classifier_V9.qza |  Unweighted (uniform) naive-bayes classifier for 18S V9 extracted from PR2 SSU v5.0.0, generated by qiime2-2021.2

edi44/100

COI and 18S metabarcoding data from Hidden Lake (Banff National Park, Canada) over two rotenone applications between 2018 and 2020.

Water samples were taken in Hidden Lake at five different time points around two rotenone applications: (i) five weeks prior to the first rotenone application, on July 12 2018; (ii) approximately three weeks after the first application of rotenone, on 7 September 2018; (iii) approximately 10 months after the first rotenone application, on 10 July 2019; (iv) four weeks following the final treatment of rotenone on the 17 September 2019; and (v) one year after the final rotenone treatment, on 19 August 2020. For each time point there is a pelagic, a littoral and a profundal sample. COI and 18S metabarcoding methods were used to produce community data. The objective of this study was to assess the non-target effect of rotenone application (in summer 2018 and 2019) on aquatic communities (i.e. phytoplankton, fungi, zooplankton and benthic macroinvertebrates).

openCC (other)Sep 2023View details →

opencc-by-4.0Nov 2020View details →

Tara Pacific 18S-based coral host genetic analysis data release version 1

This dataset contains 4 tables and 3 sets of figures related to the primary analysis of the 18S metabarcoding sequencing output. This dataset is only concerned with the identity of the coral host (i.e. not additional protist diversity). The samples included in this dataset have a 'sample-material_label' value of 'CORAL' and 'sampling-protocol_label' value of 'SEQ-CS4L'. They represent the coral samples collected at all 32 of the islands visited in the Tara Pacific expedition.

opencc-by-4.0Jun 2021View details →

Fig. 27. Maximum likelihood tree from the concatenated data set with COI, 28S and 18S in Revision of the Merodon bombiformis group (Diptera: Syrphidae) - rare and endemic African hoverflies

Fig. 27. Maximum likelihood tree from the concatenated data set with COI, 28S and 18S rRNA gene sequences.

opencc-by-4.0Dec 2014View details →

Fig. 6. RAxML tree for 18S in Two New Species of Centrohelid Heliozoans: Acanthocystis costata sp. nov. and Choanocystis symna sp. nov.

Fig. 6. RAxML tree for 18S rRNA genes of 8 pterocystid heliozoans (1320 nucleotide positions). Only bootstrap values more than 50% are shown. New sequence is in bold.

opencc-by-4.0Dec 2014View details →

Fig. 5. RAxML tree for 18S in Two New Species of Centrohelid Heliozoans: Acanthocystis costata sp. nov. and Choanocystis symna sp. nov.

Fig. 5. RAxML tree for 18S rRNA genes of 16 heliozoans from the genus Acanthocystis and Polyplacocystis ambigua as an outgroup (1520 nucleotide positions). Only bootstrap values more than 50% are shown. New sequence is in bold. Crossed branches were shortened fourfold.

opencc-by-4.0Sep 2021View details →

Fig. 17. Phylogenetic hypothesis using nuclear gene sequences TMO-4C4 and 18S in A New Genus and Species of Pygmy Pipehorse from Taitokerau Northland, Aotearoa New Zealand, with a Redescription of Acentronura Kaup, 1853 and Idiotropiscis Whitley, 1947 (Teleostei, Syngnathidae)

Fig. 17. Phylogenetic hypothesis using nuclear gene sequences TMO-4C4 and 18S retrieved with Maximum Likelihood (ML), Maximum Parsimony (MP), and Bayesian Inference (MrBayes), representing 17 species from clade 6 from the analysis of Hamilton et al. (2017) and the new taxon. Tree rooted with the southern Australian trunk-brooder pipefish Heraldia nocturna. Nodal support at the generic level is shown in ML/MP/MrBayes order. See Data Accessibility for tree file.

opencc-by-4.0Jul 2022View details →

rDNA 18S V9 metabarcoding tables (Swarm) for Tara Oceans Expedition (2009-2013), including Tara Polar Circle Expedition (2013)

Reads were grouped into OTUs using the following swarm-based pipeline: paired-end reads were merged with vsearch’s --fastq_mergepairs command (version 2.15.1, allowing for staggered reads; Rognes et al., 2016), and trimmed with cutadapt (version 3.0; Martin, 2011), keeping only reads containing both forward and reverse primers. After trimming, the expected error per read was estimated with vsearch’s command --fastq_filter and the option --eeout. Each sample was then de-replicated, i.e. strictly identical reads were merged, using vsearch’s command --derep_fulllength, and converted into fasta format. Clustering was performed at the sample level with swarm 3.0 using default parameters (Mahé et al., 2015). Prior to global clustering, individual fasta files (one per sample) were pooled and further dereplicated with vsearch. Files containing per-read expected error values were also dereplicated to retain only the lowest expected error for each unique sequence. Global clustering was performed with swarm (using the fastidious option). Cluster representative sequences were then searched for chimeras with vsearch’s command --uchime_denovo using default parameters (Edgar et al., 2011). Clustering results, expected error values, taxonomic assignments, and chimera detection results were used to build a “raw” occurrence table. Reads without primers, reads shorter than 32 nucleotides and reads with uncalled bases (“N”) were discarded. For a “filtered” occurrence table, non-chimeric sequences, sequences with an expected error per nucleotide below 0.0002, and clusters containing at least 2 reads were retained. Since primer trimming is not perfect, some sequences can still contain primer fragments or be excessively trimmed. These sub- or super-sequences were identified using vsearch and merged with their closest, most abundant perfectly trimmed sequence. Finally, occurrence patterns throughout our sample collection were used to further refine the occurrence table. Clusters that contain sub-clusters with only a single-nucleotide difference but with different ecological patterns (defined here as uncorrelated abundance values in at least 5% of the samples) were turned into distinct clusters (https://github.com/frederic-mahe/fred-metabarcoding-pipeline). On the other hand, clusters with similar sequences that had correlated abundance values in at least 95% of the samples, were merged using a re-implementation of lulu's method (Frøslev et al. 2017; https://github.com/frederic-mahe/mumu).

opencc-by-4.0Apr 2024View details →

Assessment of microphytobenthos communities in the Kinzig catchment using photosynthesis-related traits, digital light microscopy and 18S-V9 amplicon sequencing

This folder contains the datasets used in the article submitted to Frontiers in Ecology and Evolution in which we investigated the functional and compositional responses of microphytobenthos communities to surrounding land uses in the Kinzig River catchment, central Germany. We measured photosynthetic biomass using a Benthotorch, and analysed the diatom community using a newly developed digital light microscopy approach and 18S-V9 amplicon sequencing to characterise the whole protistan assemblages at sampling sites located in rural vs. urban areas. The folder contain the following datasets: kinzig2021_18SV9_filtered.csv  # microphytobenthos 18SV9 amplicon sequencing data kinzig_paper.csv # OMNIDIA output of diatom data from microscopy and diatom subset from 18SV9 amplicon sequencing (including 4 letters OMINIDIA taxa codes for diatoms) kinzig2021_benthotorch.csv # Photosynthetic biomass (BenthoTorch data) Kinzig2021_fieldData.csv # environmental data env_dataKinz2021.csv # environment dataset Kinzig2021_diatDM&18S.R # Rscript used for analysis

Fig. 8. A – 18S in A Hotspot of Amoebae Diversity: 8 New Naked Amoebae Associated with the Planktonic Bloom-forming Cyanobacterium Microcystis

Fig. 8. A – 18S rDNA maximum likelihood phylogeny of Angulamoeba. Sequences new for this study are indicated in bold. ML bootstrap values respectively posterior probabilities are shown at the nodes. GenBank accession numbers are given together with the species names. B – LM pictures of Angulamoeba microcystivorans (strains A1WVB (1, 2, 4) and A4WVB (3)) showing the characteristic rusty-colored plasmodium-like mucilage matrix with embedded trophozoites devouring a culture of Microcystis aeruginosa colonies (1–2), multi-vacuolated trophozoites that are seemingly connected by their filopodia (3) and amoeba-flagellates in different stages of transition (4). Scale bars: 200 µm (1), 100 µm (2), 20 µm (3, 4).

Fig. 6. A – 18S in A Hotspot of Amoebae Diversity: 8 New Naked Amoebae Associated with the Planktonic Bloom-forming Cyanobacterium Microcystis

Fig. 6. A – 18S rDNA maximum likelihood phylogeny of Vexillifera, including the Microcystis-associated strain (in bold). ML bootstrap values respectively posterior probabilities are shown at the nodes. GenBank accession numbers are given together with the species names. B – LM pictures of locomotive (1–7, 12–13) and floating (8–11) amoebae. Microcystis cells inside food vacuoles are visible in (1–2) and (13). The arrow in (5) points to a temporal, uroid-like structure sometimes visible during locomotion. Scale bars: 20 µm.

Fig. 4. A – 18S in A Hotspot of Amoebae Diversity: 8 New Naked Amoebae Associated with the Planktonic Bloom-forming Cyanobacterium Microcystis

Fig. 4. A – 18S rDNA maximum likelihood phylogeny of the family Hartmannellidae, including Microcystis-associated strains of Copromyxa (in bold). ML bootstrap values respectively posterior probabilities are shown at the nodes. GenBank accession numbers are given together with the species names. B – LM pictures of C. microcystidis showing locomotive trophozoites (1–7, 10) containing a pronounced hyaline cap (white arrowheads), a vesicular nucleus with globular nucleolus (white arrows), big crystals (black arrows) and Microcystis cells inside food vacuoles (black arrowheads), non-oriented moving trophozoites (8–9, 11), a grazing amoeba capturing a Microcystis cell (12–14), the floating form (15) and a double-walled cyst stage (16). C – LM pictures of C. vandevyveri showing locomotive trophozoites (1, 6–9), trophozoites during non-oriented movement (2–5, 10–12) and floating forms (13–15). Black arrows indicate the presence of small, refractive crystals in the cytoplasm, the white arrow shows the vesicular nucleus with a globular lacuna-containing nucleolus, white arrowheads indicate a pronounced hyaline cap. Ingested Microcystis cells are visible in (9) and (11). Scale bars: 20 µm.

Fig. 2. A – 18S in A Hotspot of Amoebae Diversity: 8 New Naked Amoebae Associated with the Planktonic Bloom-forming Cyanobacterium Microcystis

Fig. 2. A – 18S rDNA maximum likelihood phylogeny of Korotnevella, including Microcystis-associated strains (in bold). ML bootstrap values respectively posterior probabilities are shown at the nodes. GenBank accession numbers are given together with the species names. B – LM pictures of K. jeppesenii (strain A1JEPDK) showing trophozoites in non-oriented movement (1–5), during locomotion (6, 8) and during grazing on Microcystis aeruginosa cells (7) with the arrow indicating a lacuna-containing nucleolus. C – LM pictures of K. pelagolacustris (strains A8WVB (7, 12), A16WVB (6, 8, 11), A21WVB (1, 13), A54WVB (3–5) and A1LMS (2, 9, 10)) showing trophozoites in different stages of non-oriented movement (1–4, 6), the locomotive form (8–12), grazing amoebae with Microcystis cells inside food vacuoles (5, 10), the cyst stage (7) and the floating form (13). Arrows indicate the nucleus with clearly visible nucleolus (in 8, 10, 12). Scale bars: 20 µm.