Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
138
datasets available to search
ShareScore release 0.9.0
Dataset results
138 results for “Adaptive differentiation”
Data from: Local adaptation in shell shape traits of a brooding chiton with strong population genomic differentiation
<p class="MsoNormal"><span>Comparing divergence in quantitative tr</span><span>aits and neutral m</span><span>olecular markers, such as <em>Q</em><sub>ST</sub><em>–F</em><sub>ST</sub> comparisons, provides a means to distinguish between natural selection and genetic drift as causes of population differentiation in complex polygenic traits. </span><em>Onithochiton neglectus</em> (Rochebrune, 1881) is a morphologically variable chiton endemic to New Zealand, with populations distributed over a broad latitudinal environmental gradient. In this species, the morphological variants cluster into two geographically separated shell shape groups, and the phenotypic variation in shell shape has been hypothesised to be adaptive. Here, we assessed this hypothesis by comparing neutral genomic differentiation between populations (<em><span>F<sub>ST</sub></span></em><span>)</span> with an index of phenotypic differentiation (<em>P<sub>ST</sub></em>). We used 7,562 putatively neutral single nucleotide polymorphisms (SNPs) across 15 populations and three clades of <em>O. neglectus</em> throughout New Zealand to infer <em><span>F<sub>ST</sub></span></em>. <em>P<sub>ST</sub></em> was calculated from 18 shell shape traits and gave highly variable estimates across populations, clades and shape groups. By systematically comparing <em>P<sub>ST</sub></em> with <em>F<sub>ST</sub></em><sub>,</sub> we identified evidence of local adaptation in a number of the <em>O. neglectus </em>shell shape traits. This <span>supports the hypothesis that shell shape could be an adaptive trait, potentially correlated with the ability to live and raft in kelp holdfasts.</span></p>
Fig 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
Fig 1: Relative gene expression in tambaqui juveniles farmed in two Brazilian regions: Northern (Balbina; BA) and Southeast (Brumado; BRU). Different letters represent statistical differences between populations. The graphs show expression of A) hif-1α (p = 0.137), B) hsp-70 (p = 0.465), C) mstn (p = 0.907), D) ube3a (p = 0.205), E) ras (p = 0.041), F) cry-1 (p = 0.001), G) per-1 (p = 0.001), H) ogt (p = 0.001) and I) acly (p = 0.025).
Fig 3 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
Fig 3: IBR analyses of relative gene expression in Balbina (BA) and Brumado (BRU) populations. The IBR values are 42.7 (Balbina) and 6.79 (Brumado).
Fig 2 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
Fig 2: Heatmap of relative expression in Balbina (BA) and Brumado (BRU) populations. The colour scale ranges from blue (low transcript levels) to red (high transcript levels).
Climate adaptation and genetic differentiation in the mosquito species Culex tarsalis
<p>The increasing prevalence of vector-borne diseases around the world highlights the pressing need for an in-depth exploration of the genetic and environmental factors that shape the adaptability and widespread distribution of mosquito populations. This research focuses on <em>Culex tarsalis</em>, a principal vector for various viral diseases including West Nile Virus (WNV). Through the development of a new reference genome and the examination of Restriction-Site Associated DNA sequencing (RAD-seq) data from over 300 individuals and 28 locations, we demonstrate that variables such as temperature, evaporation rates, and the density of vegetation significantly impact the genetic makeup of <em>Cx. tarsalis</em> populations. Among the alleles most strongly associated with environmental factors is a nonsynonymous mutation in a key gene related to circadian rhythms. These results offer new insights into the mechanisms of spread and adaptation in a key North American vector species, which is poised to become a growing health threat to both humans and animals in the face of ongoing climate change.</p>
Fig. 2 in Genetic and morphological differentiation among populations of the narrowly endemic and karst forest-adapted Pilea pteridophylla (Urticaceae)
Fig. 2 Morphological variation among individuals of Pilea pteridophylla sampled along its distribution range in the tropical karst forest of southern Mexico. Plot of individual scores for the first two components of the principal component analysis using morphological data. Coloured symbols represent the two populations recognized for the species: red circles, Tabasco; and blue circles, Chiapas. Ellipses correspond to the 95% confidence intervals estimated for each population. The lines represent the dispersion of the individuals within each population
Fig. 3 in Genetic and morphological differentiation among populations of the narrowly endemic and karst forest-adapted Pilea pteridophylla (Urticaceae)
Fig. 3 Statistical parsimony networks of rps16-trnQ, trnL-trnF and rps16-trnQ + trnL-trnF dataset using the gaps as missing data. Coloured symbols represent the two populations recognized for the species: red circles, Tabasco; and blue circles, Chiapas. Open-white circles represent the number of mutational steps between haplotypes. The size of the circles is proportional to the frequency of each haplo-
Fig. 1 in Genetic and morphological differentiation among populations of the narrowly endemic and karst forest-adapted Pilea pteridophylla (Urticaceae)
Fig. 1 Mountain karst forests of Mexico and the studied species Pilea pteridophylla A. K. Monro (Urticaceae). A Geographic distribution of the Mountain karst forests of Mexico. B Individual from the Chiapas population. C Individual from the Tabasco population
Differential selection for survival and for growth in adaptive laboratory evolution experiments with benzalkonium chloride
Open the record for dataset details and reuse information.
Climate adaptation and genetic differentiation in the mosquito species <em>Culex tarsalis</em>
Open the record for dataset details and reuse information.
Data from: Local adaptation in shell shape traits of a brooding chiton with strong population genomic differentiation
Open the record for dataset details and reuse information.
Genomic differentiation and local adaptation on a microgeographic scale in a resident songbird
<p>Elucidating forces capable of driving species diversification in the face of gene flow remains a key goal in evolutionary biology. Song sparrows, Melospiza melodia, occur as 25 subspecies in diverse habitats across North America, are among the continent's most widespread vertebrate species, and are exemplary of many highly variable species for which the conservation of locally adapted populations may be critical to their range-wide persistence. We focus here on six morphologically distinct subspecies resident in the San Francisco Bay region, including three salt-marsh endemics and three residents in upland and riparian habitats adjacent to the Bay. We used reduced-representation sequencing to generate 2,773 SNPs to explore genetic differentiation, spatial population structure, and demographic history. Clustering separated individuals from each of the six subspecies, indicating subtle differentiation at microgeographic scales. Evidence of limited gene flow and low nucleotide diversity across all six subspecies further supports a hypothesis of isolation among locally adapted populations. We suggest that natural selection for genotypes adapted to salt marsh environments and changes in demography over the past century have acted in concert to drive the patterns of diversification reported here. Our results offer evidence of microgeographic specialization in a highly polytypic bird species long discussed as a model of sympatric speciation and rapid adaptation, and they support the hypothesis that conserving locally adapted populations may be critical to the range-wide persistence of similarly highly variable species.</p>
Data from: Continental-level population differentiation and environmental adaptation in the mushroom Suillus brevipes
Recent advancements in sequencing technology allowed researchers to better address the patterns and mechanisms involved in microbial environmental adaptation at large spatial scales. Here we investigated the genomic basis of adaptation to climate at the continental scale in Suillus brevipes, an ectomycorrhizal fungus symbiotically associated with the roots of pine trees. We used genomic data from 55 individuals in seven locations across North America to perform genome scans to detect signatures of positive selection and assess whether temperature and precipitation were associated with genetic differentiation. We found that S. brevipes exhibited overall strong population differentiation, with potential admixture in Canadian populations. This species also displayed genomic signatures of positive selection as well as genomic sites significantly associated with distinct climatic regimes and abiotic environmental parameters. These genomic regions included genes involved in transmembrane transport of substances and helicase activity potentially involved in cold stress response. Our study sheds light on large-scale environmental adaptation in fungi by identifying putative adaptive genes and providing a framework to further investigate the genetic basis of fungal adaptation.
Data from: Differential adaptation to a harsh granite outcrop habitat between sympatric Mimulus species
Understanding which environmental variables and traits underlie adaptation to harsh environments is difficult since many traits evolve simultaneously as populations or species diverge. Here we investigate the ecological variables and traits that underlie Mimulus laciniatus' adaptation to granite outcrops compared to its sympatric, mesic-adapted progenitor M. guttatus. We use fine scale measurements of soil moisture and herbivory to examine differences in selective forces between the species' habitats, and measure selection on flowering time, flower size, plant height, and leaf shape in a reciprocal transplant using M. laciniatus x M. guttatus F4 hybrids. We find that differences in drought & herbivory drive survival differences between habitats, that M. laciniatus and M. guttatus are each better adapted to their native habitat, and differential habitat selection on flowering time, plant stature, and leaf shape. While early flowering time, small stature, and lobed leaf shape underlie plant fitness in M. laciniatus' seasonally dry environment, increased plant size is advantageous in a competitive mesic environment replete with herbivores like M. guttatus'. Given that we observed divergent selection between habitats in the direction of species differences, we conclude that adaptation to different microhabitats is an important component of reproductive isolation in this sympatric species pair.
Data from: Landscape genomics and a common garden trial reveal adaptive differentiation to temperature across Europe in the tree species Alnus glutinosa
The adaptive potential of tree species to cope with climate change has important ecological and economic implications. Many temperate tree species experience a wide range of environmental conditions, suggesting high adaptability to new environmental conditions. We investigated adaptation to regional climate in the drought-sensitive tree species Alnus glutinosa (Black alder), using a complementary approach that integrates genomic, phenotypic and landscape data. A total of 24 European populations were studied in a common garden and through landscape genomic approaches. Genotyping-By-Sequencing was used to identify SNPs across the genome, resulting in 1990 SNPs. Although a relatively low percentage of putative adaptive SNPs was detected (2.86% outlier SNPs), we observed clear associations among outlier allele frequencies, temperature, and plant traits. In line with the typical drought avoiding nature of A. glutinosa, leaf size varied according to a temperature gradient and significant associations with multiple outlier loci were observed, corroborating the ecological relevance of the observed outlier SNPs. Moreover, the lack of isolation-by-distance, the very low genetic differentiation among populations and the high intra-population genetic variation all support the notion that high gene exchange combined with strong environmental selection promotes adaptation to environmental cues.
Data for: Adaptive tail-length evolution in deer mice is associated with differential Hoxd13 expression in early development
<p>Variation in the size and number of axial segments underlies much of the diversity in animal body plans. Here, we investigate the evolutionary, genetic, and developmental mechanisms driving tail-length differences between forest and prairie ecotypes of deer mice (<em>Peromyscus maniculatus</em>). We first show that long-tailed forest mice perform better in an arboreal locomotion assay, consistent with tails being important for balance during climbing. We then identify six genomic regions that contribute to differences in tail length, three of which associate with caudal vertebra length and the other three with vertebra number. For all six loci, the forest allele increases tail length, indicative of the cumulative effect of natural selection. Two of the genomic regions associated with variation in vertebra number contain Hox gene clusters. Of those, we find an allele-specific decrease in Hoxd13 expression in the embryonic tail bud of long-tailed forest mice, consistent with its role in axial elongation. Additionally, we find that forest embryos have more presomitic mesoderm than prairie embryos, and that this correlates with an increase in the number of neuromesodermal progenitors (NMPs), which are modulated by Hox13 paralogs. Together, these results suggest a role for Hoxd13 in the development of natural variation in adaptive morphology on a microevolutionary timescale.</p>
Data for Rapid phenotypic differentiation and local adaptation in Japanese knotweed s.l. (Reynoutria japonica and R. × bohemica, Polygonaceae) invading novel habitats
<p><span><strong>PREMISE:</strong> Many plant invaders like the Japanese knotweeds are thought to colonize new habitats with low genetic diversity. Such species provide an opportunity to study rapid adaptation to complex environmental conditions.</span></p> <p><span><strong>METHODS:</strong> Using replicate reciprocal transplants of clones across three habitats, we described patterns of phenotypic response and assessed degree of local adaptation.</span></p> <p><span><strong>KEY RESULTS:</strong> We found plants from beach habitats had decreased height, number of leaves, leaf area, and biomass allocation to roots and shoots compared to plants from marsh and roadside habitats when grown in their home habitat. In the marsh habitat, marsh plants were generally larger than beach plants, but not different from roadside plants. There were no differences among plants from different habitats grown in the roadside habitat. Despite this evidence of differentiation in beach and marsh habitats, we found mixed evidence for local adaptation. In their "home site" plants from the marsh habitat had greater biomass than plants from the beaches but not compared to plants from roadsides. Biomass comparisons in other habitats were either maladaptive or not significant. However, plants from the roadside had greater survival in their "home site" compared to foreign plants. There were no differences in survival in the other habitats.</span></p> <p><span><strong>CONCLUSIONS:</strong> We found phenotypic differentiation associated with habitats despite the low reported genetic diversity for these populations. Our results partially support the hypothesis of local adaptation in marsh and roadside habitats. Identifying whether these patterns of differentiation result from genetic or heritable non-genetic mechanisms will require further work.</span></p>
Genetic differentiation and signatures of local adaptation revealed by RADseq for a highly-dispersive mud crab Scylla olivacea in the Sulu Sea
<p><b>Connectivity of marine populations is shaped by complex interactions of biological and physical processes across the seascape. The influence of environmental features on the genetic structure of populations has key implications to the dynamics and persistence of populations, and an understanding of spatial scales and patterns of connectivity is crucial for management and conservation. This study employed a seascape genomics approach combining larval dispersal modeling and population genomic analysis using single nucleotide polymorphisms (SNPs) obtained from RADseq to examine environmental factors influencing patterns of genetic structure and connectivity for a highly-dispersive mud crab, <em>Scylla olivacea</em> (Herbst, 1796) in the Sulu Sea. Dispersal simulations reveal widespread but asymmetric larval dispersal influenced by persistent southward and westward surface circulation features in the Sulu Sea. Despite potential for widespread dispersal across the Sulu Sea, significant genetic differentiation was detected among eight populations based on 1,655 SNPs (<em>F</em><sub>ST </sub> = 0.0057, p < 0.001) and a subset of 1,643 putatively neutral SNP markers (<em>F</em><sub>ST</sub></b><b> = 0.0042, p < 0.001). Oceanography influences genetic structure, with redundancy analysis (RDA) indicating significant contribution of asymmetric ocean currents to neutral genetic variation (R<sup>2</sup><sub>adj</sub> = 0.133; p = 0.035). Genetic structure may also reflect demographic factors, with divergent populations characterized by low effective population sizes (<em>N</em>e < 50). Pronounced latitudinal genetic structure was recovered for loci putatively under selection (</b><b><em>F</em><sub>ST</sub></b><b> = 0.2390, p < 0.001), significantly correlated with sea surface temperature variabilities during peak spawning months for <em>S. olivacea</em> (R<sup>2</sup><sub>adj</sub> = 0.692-0.763; p < 0.050), suggesting putative signatures of selection and local adaptation to thermal clines. While oceanography and dispersal ability likely shape patterns of gene flow and genetic structure of <em>S. olivacea</em> across the Sulu Sea, the impacts of genetic drift and natural selection influenced by sea surface temperature also appear as likely drivers of population genetic structure. This study contributes to the growing body of literature documenting population genetic structure and local adaptation for highly-dispersive marine species, and provides information useful for spatial management of the fishery resource.</b></p>
Table 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
<p><b>Table 1:</b> Details of target genes (<i>hif-1α</i>, <i>hsp70</i>, <i>ras</i>, <i>mstn</i>, <i>acly</i>, <i>per-1</i>, <i>cry-1</i>, <i>ube3a</i> and <i>ogt</i>) and reference genes (<i>β- tubulin</i> and <i>β- actin</i>) primers.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Length (bp)</b></th><th><b>R</b> <b>2</b></th><th><b>Efficiency (%)</b></th><th><b>Primers sequence (5ʹ-3ʹ) forward/reverse</b></th></tr></tbody><tbody><tr><th><i>tubulin</i> -F</th><td>20</td><td>0.99</td><td>109.5</td><td>GACGTGGTGCCCAAAGATGT</td></tr><tr><th><i>tubulin</i> -R</th><td>18</td><td>TGGATGGTGCGCTTGGT</td></tr><tr><th><i>β- actin</i> -F</th><td>21</td><td>0.99</td><td>100.5</td><td>GCTGTTTTCCCCTCCATTGTT</td></tr><tr><th><i>β- actin</i> -R</th><td>19</td><td>TCCCATGCCAACCATCACT</td></tr><tr><th><i>hif-1α</i> -F</th><td>20</td><td>0.99</td><td>105.2</td><td>CTTCTGAGCTCTGATGAGGC</td></tr><tr><th><i>hif-1α</i> -R</th><td>20</td><td>GAAAGCACCATCAGGAAGCC</td></tr><tr><th><i>hsp-70</i> -F</th><td>20</td><td>0.99</td><td>100.9</td><td>GCAAGGAGAACAAGATCACC</td></tr><tr><th><i>hsp-70</i> -R</th><td>19</td><td>CACTCCGTTGCACTTGTCC</td></tr><tr><th><i>mstn</i> -F</th><td>20</td><td>0.98</td><td>100.5</td><td>AATCCAAGCGAGGGAAAAGC</td></tr><tr><th><i>mstn</i> -R</th><td>22</td><td>CCTCCATCACCTGAAAGGTCTT</td></tr><tr><th><i>ras</i> -F</th><td>20</td><td>0.97</td><td>99.31</td><td>CCAGTACATGAGGACAGGAG</td></tr><tr><th><i>ras</i> -R</th><td>20</td><td>CAAGCACCATTGGCACATCG</td></tr><tr><th><i>acly</i> -F</th><td>19</td><td>0.99</td><td>100.7</td><td>ATCATCTCCCGCACTACAG</td></tr><tr><th><i>acly</i> -R</th><td>19</td><td>TACCTCCAATCTCTCCCAG</td></tr><tr><th><i>ube3a</i> -F</th><td>21</td><td>0.98</td><td>103.3</td><td>GCCATAAGCAAGCAGCACAAC</td></tr><tr><th><i>ube3a</i> -R</th><td>19</td><td>CCAGTCAGTCCGCACATCG</td></tr><tr><th><i>per-1</i> -F</th><td>20</td><td>0.98</td><td>104.1</td><td>TGTTGAAGTTTGTGCCCCAG</td></tr><tr><th><i>per-1</i> -R</th><td>18</td><td>CAGTCCAGATGCTCCTCC</td></tr><tr><th><i>cry-1</i> -F</th><td>19</td><td>0.99</td><td>103.6</td><td>GTCCAACAGCCCTCAAACT</td></tr><tr><th><i>cry-1</i> -R</th><td>18</td><td>TACGCCAAGCACTCCAGA</td></tr><tr><th><i>ogt</i> -F</th><td>19</td><td>0.99</td><td>104.1</td><td>CCTCCCTTTGCTGTGTTCC</td></tr><tr><th><i>ogt</i> -R</th><td>20</td><td>TGTCTGCTTTCCGCTTTCGC</td></tr></tbody></table>
Data from: Genomic differentiation during speciation-with-gene-flow: comparing geographic and host-related variation in divergent life history adaptation in Rhagoletis pomonella
A major goal of evolutionary biology is to understand how variation within populations gets partitioned into differences between reproductively isolated species. Here, we examine the degree to which diapause life history timing, a critical adaptation promoting population divergence, explains geographic and host-related genetic variation in ancestral hawthorn and recently derived apple-infesting races of Rhagoletis pomonella. Our strategy involved combining experiments on two different aspects of diapause (initial diapause intensity and adult eclosion time) with a geographic survey of genomic variation across four sites where apple and hawthorn flies co-occur from north to south in the Midwestern USA. The results demonstrated that the majority of the genome showing significant geographic and host-related variation can be accounted for by initial diapause intensity and eclosion time. Local genomic differences between sympatric apple and hawthorn flies were subsumed within broader geographic clines; allele frequency differences within the races across the Midwest were 2 to 3-fold greater than those between the races in sympatry. As a result, sympatric apple and hawthorn populations displayed more limited genomic clustering compared to geographic populations within the races. The findings suggest that with reduced gene flow and increased selection on diapause equivalent to that seen between geographic sites, the host races may be recognized as different genotypic entities in sympatry, and perhaps species, a hypothesis requiring future genomic analysis of related sibling species to R. pomonella to test. Our findings concerning the way selection and geography interplay could be of broad significance for many cases of earlier stages of divergence-with-gene flow, including (1) where only modest increases in geographic isolation and the strength of selection may greatly impact genetic coupling and (2) the dynamics of how spatial and temporal standing variation is extracted by selection to generate differences between new and discrete units of biodiversity.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.