Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
112
datasets available to search
ShareScore release 0.7.1
Dataset results
112 results for “Dugesia”
Figure 7 in Endemic freshwater planarians of Sardinia: Redescription of Dugesia hepta (Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus
Figure 7. Dugesia hepta: light micrograph sections through the copulatory apparatus. (A) Frontal section showing the ejaculatory duct opening laterally on the right with respect to the apex of the penis papilla. Haematoxylin eosin. (B) Transverse section of the penis papilla protruding in the atrium. Note the dorsal position of the ejaculatory duct and the spermatophore in the lumen. Heidenhain's iron haematoxylin. (C) Transverse section of the ejaculatory duct surrounded by numerous glands. Alcian blue. (D) Transverse section of the atrium with spermatophores in the lumen. Note shell glands opening in its centre-lateral area. Haematoxylin eosin. (E) Detail of the atrium showing luminal epithelium. Transverse section. (F) Transverse section of numerous cement glands. (E, F) Heidenhain's iron haematoxylin.
Figure 6 in Endemic freshwater planarians of Sardinia: Redescription of Dugesia hepta (Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus
Figure 6. Dugesia hepta: light micrograph sections through the copulatory apparatus. (A) transverse section of the penial fold and the penis bulb. Note both vasa deferentia opening in the seminal vesicle. (B) Detail of the penial fold of glandular type. Transverse section. (C) Detail of the penis bulb showing the bulb glands. Transverse section. (A–C) Heidenhain's iron haematoxylin.
Figure 4. Dugesia hepta. DIZAB Pla 3.6 in Endemic freshwater planarians of Sardinia: Redescription of Dugesia hepta (Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus
Figure 4. Dugesia hepta. DIZAB Pla 3.6. Frontal reconstruction of the copulatory apparatus (anterior is to the top).
Figure 5 in Endemic freshwater planarians of Sardinia: Redescription of Dugesia hepta (Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus
Figure 5. Dugesia hepta. Light micrograph sections through the copulatory apparatus. (A) Transverse section of the bursa copulatrix. Note the false seminal vesicles. Heidenhain's iron haematoxylin. (B) Transverse section of the bursal canal. Pasini. (C) Sagittal section showing the penis bulb containing the seminal vesicle, the penis papilla with the ejaculatory duct, the penial fold localized between the penis bulb and the penis papilla. Note a spermatophore in the atrium. Haematoxylin eosin.
Figure 3. Dugesia hepta. Neotype DIZAB Pla 3.1 in Endemic freshwater planarians of Sardinia: Redescription of Dugesia hepta (Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus
Figure 3. Dugesia hepta. Neotype DIZAB Pla 3.1. Sagittal reconstruction of the copulatory apparatus (anterior is to the right).
Figure 1 in Endemic freshwater planarians of Sardinia: Redescription of Dugesia hepta (Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus
Figure 1. Dugesia hepta. Geographic range in four hydrographic basins in NW Sardinia: (A) Rio Mannu di Portotorres ; ( B ) River Silis ; (C) River Coghinas ; (D ) River Temo. Type locality in the Rio Sorgenti San Martino is
Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.
Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.
Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Figure 4 in Genetic diversity, population structure and demographic history of Dugesia japonica in Taihang Mountains
Figure 4. Median-joining haplotype network based on mitochondrial gene COI. The four ellipses represent four clades in Figure 3, respectively. Each circle represents a haplotype, the area of the circle is proportional to the frequency of haplotypes, and black dots represent hypothetical unobserved haplotypes. Different populations are shown in different colors.
Figure 3 in Genetic diversity, population structure and demographic history of Dugesia japonica in Taihang Mountains
Figure 3. Maximum likelihood (ML) and Bayesian inference (BI) phylogentic trees based on mitochondrial gene COI. Dugesia ryukyuensis (Genbank accession no. AB618488) serves as the outgroup. The broken lines denote inconsistent branches. Bootstrap percentages (BP,>50 only) of ML analysis and posterior probabilities (PP,>0.50 only) of Bayesian inference are shown above and below the branch, respectively. HG—haplogroup.
Dugesia (Tricladida, Platyhelminthes) Cox1, 18S, 28S, ITS-1, DUNUC3, DUNUC5 datasets for worldwide biogeographic study
<p><strong><span>Aim:</span></strong><span> Freshwater planarians may have a wide geographic range despite their assumed low vagility. </span><span>Found across four continents, <em>Dugesia</em> may have either an ancient origin on a large paleo landmass, followed by colonisation in different regions before continental fragmentation, or a more recent origin and subsequent transoceanic dispersal. We seek to resolve between these two hypotheses.</span></p> <p><strong><span>Location:</span></strong><span><strong> </strong>Africa, Eurasia, and Australasia</span></p> <p><strong>Taxon: </strong><em>Genus Dugesia</em> (Platyhelminthes: Tricladida: Dugesiidae)</p> <p><strong><span>Methods:</span></strong><span> We used data from the sequencing of six gene fragments and comprehensive taxonomic sampling of <em>Dugesia</em> from across its </span><span>distribution range to reconstruct the phylogeny of this genus using maximum likelihood and bayesian inference methods. We conducted two phylogenetic dating analyses using Platyhelminthes fossils and palaeogeological events. Basing on the time-calibrated molecular phylogenetic framework we evaluated the contribution of vicariance and dispersal to the biogeographic evolution of <em>Dugesia</em>. By reconstructing the ancestral areas and present-day potential distribution using BioGeoBEARS and niche modelling, we elucidated the biogeographic history of the genus.</span></p> <p><strong><span>Results:</span></strong> <span>The present-day distribution of <em>Dugesia</em> is a result of different vicariance and dispersal events. However, we also found evidence of transoceanic dispersal. Consistent with previous hypotheses, <em>Dugesia</em> dates to the Upper Jurassic in the Afro-Malagasy Gondwana region. We unveiled a novel biogeographic scenario for the genus, involving multiple events of colonisation in Eurasia from continental Africa via at least three dispersal routes.</span></p> <p><strong><span>Main conclusions:</span></strong><span> <em>Dugesia</em> is an ancient genus having reached its present distribution through a complex history of dispersal and vicariant events following its origin in southern Gondwana. Despite the low vagility of <em>Dugesia</em>, we found evidence of their overseas dispersal.</span></p>
Figure 2 in Endemic freshwater planarians of Sardinia: Redescription of Dugesia hepta (Platyhelminthes, Tricladida) with a comparison of the Mediterranean species of the genus
Figure 2. Dugesia hepta. External features (from photographs of living specimens).
Figure 1 in Genetic diversity, population structure and demographic history of Dugesia japonica in Taihang Mountains
Figure 1. Geographical distribution of Dugesia japonica populations sampled in Taihang Mountains.
Datasets used for Western Mediterranean Dugesia phylotranscriptomic analyses
<p><span>The Mediterranean is one of the most biodiverse areas of the Paleartic region. Here, basing on large data sets of single copy orthologs obtained from transcriptomic data, we investigated the evolutionary history of the genus <em>Dugesia</em> in the Western Mediterranean area. The results corroborated that the complex paleogeological history of the region was an important driver of diversification for the genus, speciating as microplates and islands were forming. These processes led to the differentiation of three main biogeographic clades: Iberia-Apennines-Alps, Corsica-Sardinia, and Iberia-Africa. The internal relationships of these major clades were analysed with several representative samples per species. The use of large data sets regarding the number of <em>loci</em> and samples, as well as state-of-the-art phylogenomic inference methods allowed us to answer different unresolved questions about the evolution of particular groups, such as the diversification path of <em>D. subtentaculata</em> in the Iberian Peninsula and its colonization of Africa. Additionally, our results support the differentiation of <em>D. benazzii</em> in two lineages which could represent two species. Finally, we analysed here for the first time a comprehensive number of samples from several asexual Iberian populations whose assignment at the species level has been an enigma through the years. The phylogenies obtained with different inference methods showed a branching topology of asexual individuals at the base of sexual clades. We hypothesize that this unexpected topology is related to long-term asexuality. This work represents the first phylotranscriptomic analysis of Tricladida, laying the first stone of the genomic era in phylogenetic studies on this taxonomic group.</span></p>
Datasets used for Western Mediterranean Dugesia phylotranscriptomic analyses
Open the record for dataset details and reuse information.
Dugesia (Tricladida, Platyhelminthes) Cox1, 18S, 28S, ITS-1, DUNUC3, DUNUC5 datasets for worldwide biogeographic study
Open the record for dataset details and reuse information.
3RAD datasets used for phylogenomic, species delimitation, biogeography, and introgression analyses on Dugesia from Corsica and Sardinia
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.