Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

91

datasets available to search

ShareScore release 0.7.1

Reset

Dataset results

91 results for “Dugesiidae”

Learn how ShareScore rates datasets ↗
zenodo40/100

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

opencc-by-4.0Sep 2017View details →
zenodo40/100

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

opencc-by-4.0Sep 2017View details →
zenodo32/100

FIGURE 2 in The expansion continues: Girardia arrives in Africa. First record of Girardia sinensis (Platyhelminthes, Tricladida, Continenticola, Dugesiidae) in Morocco

FIGURE 2. Bayesian Inference tree of concatenated sequences of Cytochrome Oxidase I (COI) and Elongation Factor 1 alpha (EF1a) genes. The samples from Morocco individuals are highlighted in red. Values at nodes: posterior probability. Scale bar: number of substitutions per nucleotide position. The table shows the sequences used in the study, their taxonomic classification and GenBank accession code by gene.

opennotspecifiedAug 2022View details →
zenodo32/100

Supplementary material 1 from: Solà E, Sluys R, Segev O, Blaustein L, Riutort M (2015) The taxonomic status of Dugesia biblica from Israel and Turkey (Platyhelminthes, Tricladida, Dugesiidae). ZooKeys 506: 1-12. https://doi.org/10.3897/zookeys.506.9663

Supplementary Table 1: Explanation note: Localities in Israel from which no specimens of Dugesia could be obtained during our samplings.

opencc-by-4.0May 2015View details →
zenodo32/100

FIGURES 16–21 in Two new sympatric troglobitic freshwater flatworms (Platyhelminthes: Dugesiidae) from a hotspot of subterranean biodiversity in the Neotropics

FIGURES 16–21. Girardia paucipunctata, holotype in sagittal section: (16) dorsal surface of the body; (17) testes in the anterior region of the body; (18–20) general view of the copulatory apparatus; (21) copulatory bursa and proximal part of the bursal canal. Anterior to the left.

opennotspecifiedJun 2018View details →
zenodo32/100

FIGURES 14–15 in Two new sympatric troglobitic freshwater flatworms (Platyhelminthes: Dugesiidae) from a hotspot of subterranean biodiversity in the Neotropics

FIGURES 14–15. Girardia paucipunctata: (14) photograph of the preserved holotype in dorsal view; (15) photograph of preserved holotype in ventral view. Anterior to the left.

opennotspecifiedJun 2018View details →
zenodo32/100

FIGURE 13 in Two new sympatric troglobitic freshwater flatworms (Platyhelminthes: Dugesiidae) from a hotspot of subterranean biodiversity in the Neotropics

FIGURE 13. Girardia arenicola. Sagittal composite reconstruction of the copulatory apparatus of the holotype. The arrow indicates the joining point of the ovovitelline ducts. Anterior to the left.

opennotspecifiedJun 2018View details →
zenodo32/100

FIGURE 22 in Two new sympatric troglobitic freshwater flatworms (Platyhelminthes: Dugesiidae) from a hotspot of subterranean biodiversity in the Neotropics

FIGURE 22. Girardia paucipunctata. Sagittal composite reconstruction of the copulatory apparatus of the holotype. The arrow indicates the joining point of the ovovitelline ducts. Anterior to the left.

opennotspecifiedJun 2018View details →
zenodo32/100

FIGURES 8–12 in Two new sympatric troglobitic freshwater flatworms (Platyhelminthes: Dugesiidae) from a hotspot of subterranean biodiversity in the Neotropics

FIGURES 8–12. Girardia arenicola, in sagittal section: (8) ventral surface of the body of the holotype; (9) testes of the holotype in the anterior region of the body; (10) lateral view of the male copulatory apparatus of the holotype, showing the distal section of a sperm duct close to its opening into the bulbar cavity; (11) copulatory bursa and proximal part of the bursal canal of paratype MZU PL. 00275; (12) general view of the copulatory apparatus of the holotype. Anterior to the left.

opennotspecifiedJun 2018View details →
zenodo32/100

FIGURES 5–7 in Two new sympatric troglobitic freshwater flatworms (Platyhelminthes: Dugesiidae) from a hotspot of subterranean biodiversity in the Neotropics

FIGURES 5–7. Girardia arenicola: (5) photograph of a live specimen in dorsal view; (6) photograph of a preserved specimen (holotype) in dorsal view; (7) photograph of a preserved specimen (holotype) in ventral view. The tip of the pharynx is protruded (arrow) through the mouth. Scale bar for the fig. 5 not available. Anterior to the left.

opennotspecifiedJun 2018View details →
zenodo32/100

FIGURES 1–4 in Two new sympatric troglobitic freshwater flatworms (Platyhelminthes: Dugesiidae) from a hotspot of subterranean biodiversity in the Neotropics

FIGURES 1–4. Type-locality of Girardia arenicola and Girardia paucipunctata in "Areias de Cima" cave, in the karst area of "Areias system", Iporanga, state of São Paulo, Brazil: (1) location of the cave in southern America (modified from Rodrigues et al., 2014); (2) location of the sampling site within the cave; (3) travertine rock pool from where flatworms were collected; (4) flatworms at the bottom of the travertine rock pool. The arrowhead indicates the cave entrance; arrows indicate the sampling site.

opennotspecifiedJun 2018View details →
zenodo32/100

Figures 15, 16 in Integrative delineation of species of Mediterranean freshwater planarians (Platyhelminthes: Tricladida: Dugesiidae)

Figures 15, 16. Recurva postrema Sluys & Solà sp. nov. 15. ZMA V.Pl. 7122.4. Sagittal reconstruction of the copulatory apparatus. 16. ZMA V.Pl. 7122.1. Sagittal reconstruction of the copulatory apparatus.

opennotspecifiedOct 2013View details →
zenodo32/100

Figure 14 in Integrative delineation of species of Mediterranean freshwater planarians (Platyhelminthes: Tricladida: Dugesiidae)

Figure 14. Recurva postrema Sluys & Solà sp. nov. Photograph of external features (scale bar not available).

opennotspecifiedOct 2013View details →
zenodo32/100

Figure 18 in Integrative delineation of species of Mediterranean freshwater planarians (Platyhelminthes: Tricladida: Dugesiidae)

Figure 18. Recurva sp. Photograph of external features of specimen from Paros (scale bar not available).

opennotspecifiedOct 2013View details →
zenodo32/100

Figure 17 in Integrative delineation of species of Mediterranean freshwater planarians (Platyhelminthes: Tricladida: Dugesiidae)

Figure 17. Recurva conjuncta Sluys sp. nov. ZMA V.Pl. 7123.1. Sagittal reconstruction of the copulatory apparatus.

opennotspecifiedOct 2013View details →
zenodo32/100

Figure 13 in Integrative delineation of species of Mediterranean freshwater planarians (Platyhelminthes: Tricladida: Dugesiidae)

Figure 13. Dugesia parasagitta Sluys & Solà sp. nov. Photomicrograph of large dorsal penial fold in specimen ZMA V.Pl. 7118.1.

opennotspecifiedOct 2013View details →
zenodo32/100

Figure 9 in Integrative delineation of species of Mediterranean freshwater planarians (Platyhelminthes: Tricladida: Dugesiidae)

Figure 9. Dugesia improvisa Sluys & Solà sp. nov. Photomicrograph of penial complex of specimen ZMA V.Pl. 7116.4, showing the sickle-shaped flap of tissue or secretion.

opennotspecifiedOct 2013View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record