Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
13
datasets available to search
ShareScore release 0.9.0
Dataset results
13 results for “Fram Strait”
SPICES – Sea ice edge maps from the Fram Strait
<p>Sea ice edge maps derived from Sentinel-1 SAR dual polarisation EW images using a Support Vector Machine (SVM) algorithm. Thisalgorithm is based on a SVM approach, and in addition uses texture calculation and principal component analysis (PCA) to classify sea ice types (Korosov et al., 2016). The main steps of the algorithms include:<br> (1) pre-processing of the raw SAR data, <br> (2) calculation of texture features, <br> (3) unsupervised pre-classification of the image using PCA and k-means cluster analysis to reduce the number of ice classes, <br> (4) expert re-classification of the image into the pre-calculated classes, <br> (5) training of the SVM using input from the previous step, and <br> (6) classifying the full image into the reduced number of classes using the trained SVM. <br> To generate an ice edge product, the SVM algorithm is used with only two classes: sea ice and open water. </p> <p>Korosov, A., N. Zakhvatkina, A. Vesman, A. Mushta, and S. Muckenhuber, Sea ice classification algorithm for Sentinel-1 images, Poster at ESA Living Planet Symposium 2016, Prague, Czech Republic, 9-13 may, 2016.</p> <p> </p> <p> </p>
SPICES – Sea ice type maps from Fram Strait, Barents and Kara Sea
<p>Sea ice type classification of Sentinel-1 SAR dual polarization EW images. </p> <p>Prior to classification, Sentinel-1 SAR images have been pre-processed to remove noise [1]. The procedure of classification is comprised of the following steps: 1. Haralick texture features are computed, 2. Principal Component Analysis (PCA) is applied, 3. K-means clustering is used to group the data into 15 clusters using factor scores of the PCA as input, 4. The 15 clusters are analysed by an ice expert and classified as open water and different types of sea ice.</p> <p> </p> <p>[1] J.-W. Park, A. A. Korosov, M. Babiker, S. Sandven, J.-S. Won, Efficient Thermal Noise Removal for Sentinel-1 TOPSAR Cross-Polarization Channel, IEEE Transactions on Geoscience and Remote Sensing, 2018; 56, 3, DOI:10.1109/TGRS.2017.2765248.</p>
Linked collectors and determiners for: On the composition of the benthic fauna of the western Fram Strait.
Natural history specimen data linked to collectors and determiners held within, "On the composition of the benthic fauna of the western Fram Strait". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/8e6636ad-0b6a-426a-9515-985288f558ba">https://bionomia.net/dataset/8e6636ad-0b6a-426a-9515-985288f558ba</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/8e6636ad-0b6a-426a-9515-985288f558ba">https://gbif.org/dataset/8e6636ad-0b6a-426a-9515-985288f558ba</a>. Formatted as a Frictionless Data package.
PAH concentrations in the Fram Strait, the Canadian Arctic Archipelago and the lower Great Lakes
<p>The PEs were deployed at different water depths of deep moorings deployed in the Fram Strait during 2014-2015 (9 samples) and 2018-2019 (22 samples), as well as in surface seawater of the Canadian Arctic Archipelago (6 samples), and in the air (6 samples) and surface water (3 samples) of the lower Great Lakes during 2018-2019. For atmospheric sampling, PEs have deployed at ~1-2 m height and fixed inside two inverted bowls to prevent rainfall and direct solar radiation. For water sampling, PEs were strung on stainless steel wires and attached to stainless steel cages. The surface-water cages were fixed to subsurface floats at ~4-5 m depth, while the deep-water cages were fastened to deep moorings at different depths for ~1 year. PAH concentration data were collected.</p> <p>Supporting information for "Zhang, L., Ma, Y., Vojta, S., Morales-McDevitt, M., Hoppmann, M., Soltwedel, T., et al. (2023). Presence, Sources and Transport of Polycyclic Aromatic Hydrocarbons in the Arctic Ocean. <em>Geophysical Research Letters</em>, 50, e2022GL101496". <a href="https://doi.org/10.1029/2022GL101496">https://doi.org/10.1029/2022GL101496</a></p>
Sea ice velocity and area flux in the Fram Strait based on an improved algorithm
<p>These data are related to the paper on the sea ice velocity improvement in the Fram Strait. I provide the daily sea ice velocity and area flux in the Fram Strait. Besides, the data used for validation with buoy ice velocity are also included.</p>
Planktonic foraminifera count, shell weight and size data from sediment traps in the Fram Strait, HAUSGARTEN observatory (TDLT 2014), 2014 - 2015
<p>Counts, shell weight and shell size data of planktonic foraminifera from two depths of the sediment Trap TDLT 2014 in the HAUSGARTEN observatory in the eastern Fram Strait. Comparison of the count data done in the context of this study with count data conducted after the initial retrieval of the trapped material indicate high deviation. It is likely that the samples were affected by dissolution during the storage between retrieval (2015) and analysis (2020/2021), therefore both counts and weight and size data might not be representative.<br> <br> This data is supplement to the dissertation from Tell (2023).</p>
Planktonic foraminifera count, shell weight and size data from plankton nets from the Fram Strait (PS93.1)
<p>Planktonic foraminifera shells retrieved from different stations in the western Fram Strait (Campaign PS93.1), sampling up to 5 depth intervals at each stations. Foraminifera shells were identified to the species level after Brummer and Kucera (2022) and counted. By colouring from rose Bengal, they were divided into cytoplasm-bearing and empty shells. The average shell weight per species and shell type was measured per sample, and the individual shell size (different size parameters) for all shells.</p> <p>This data is supplement to the dissertation from Tell (2023). Part of the data is published in relation to Tell et al., 2023 on PANGAEA (https://doi.pangaea.de/10.1594/PANGAEA.941250), and species counts were also conducted and published by Greco et al. (2022), data likewise available on PANGAEA (<a href="https://doi.org/10.1594/PANGAEA.942033">https://doi.org/10.1594/PANGAEA.942033</a>).</p>
Numerical Output for Analysis of Atlantic Water Pathways in Fram Strait
<p>This dataset contains data for the publication: Shifts of the Recirculation Pathways in central Fram Strait drive Atlantic Intermediate Water Variability on Northeast Greenland shelf (McPherson et al., JGR Oceans).</p>
Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula
<p>In this study we use sedimentary ancient DNA metabarcoding from two marine sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at western Fram Strait (subarctic North Atlantic) from which we collected 12 samples including one biological replicate. The second Kastenlot core SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific) from which we collected 9 samples and 2 samples were collected from a pilot core taken next to the Kastenlot core. Total DNA was extracted from approximately 2ml sediment per sample in 3 batches with up to 9 samples and one extraction blank. Total DNA was concentrated and if necessary diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates including a PCR no template control (NTC). We amplified a diatom-specific, 76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F (AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R (TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in equal concentrations. The sequencing library was prepared with the Mid Output kit v. 2 according to the Fasteris Metafast protocol for low complexity amplicon sequencing and checked by qPCR. The library was sequenced (2 x 150 bp, paired-end) on the Illumina NextSeq 500 at the Fasteris SA sequencing service (Switzerland). For two samples we sequenced 4 PCR-products and for two samples we could only get 2 PCR-products with sufficient DNA content for sequencing.</p>
Deep Ocean storage of heat and CO2 in the Fram Strait, the Arctic Ocean during the last glacial period
<p>Mg/Ca and B/Ca, δ18O, δ13C, Bottom Water Temperature (BWT), Seawater δ18O based on the benthic foraminiferal species <em>Oridorsalis umbonatus</em> from sediment core core HH12-946MC, the Fram Strait.</p>
Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula
Open the record for dataset details and reuse information.
Dataset of Fram Strait sea ice volume export from FESOM
<p>Model data of Fram Strait sea ice volume export and related data from FESOM. The model data consist of those used in figures of a manuscript submited to JGR: Arctic sea ice decline preconditions events of anomalously low sea ice volume export through Fram Strait in the early 21st century.</p>
AWI Moored ULS Data, Greenland Sea and Fram Strait, 1991-2002, Version 1
This data set consists of Upward Looking Sonar (ULS) data from 11 moorings in the Greenland Sea. Parameters in the processed data files include ice draft, water pressure, and water temperature. Raw data files with sonar travel time, and files with draft frequency of occurrence, are available as well. A single statistical file for each mooring summarizes that mooring's record. These data were contributed by the Alfred Wegener Institute for Polar and Marine Research, Bremerhaven, Germany, in 2002 and 2004, as a contribution to the World Climate Research Programme's Arctic Climate System Study/Climate and Cryosphere (ACSYS/CliC) Project. Data are available via FTP.NSIDC strongly encourages you to register as a user of this data product. As a registered user, you will be notified of updates and corrections. When registering, please include the title of this data set, AWI Moored ULS Data, Greenland Sea and Fram Strait, 1991-2002.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.