Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
10
datasets available to search
ShareScore release 0.9.0
Dataset results
10 results for “Platocerella”
FIGURE 7 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
FIGURE 7. Maximum Likelihood phylogenetic trees based on 1000 replicates; A) 18S rRNA, B) D9-D10 expansion region of 28S rRNA, C) 5' region of COI, and D) consensus tree for concatenated sequence data for all three loci; scale bar = percent nucleotide difference.
FIGURE 2 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
FIGURE 2. Adult male habitus of Platocerella sordida sp. nov.; A) dorsal view and B) lateral view; scale bar = 1 mm.
FIGURE 4 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
FIGURE 4. Forewing venation of Platocerella sordida sp. nov.; black text = vein and italic text = crossvein.
FIGURE 3 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
FIGURE 3. Adult male of Platocerella sordida sp. nov.; A) dorsal view of head, pronotum and mesonotum, B) lateral view of head, pronotum and mesonotum and C) frontal view of head; scale bar = 1 mm.
FIGURE 6 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
FIGURE 6. Aedeagus of Platocerella sordida sp. nov.; A) right lateral view, B) left lateral view, C) dorsal view, and D) ventral view.
FIGURE 5 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
FIGURE 5. Adult male genitalia of Platocerella sordida sp. nov.; A) left lateral view, B) ventral view, and C) dorsal view.
TABLE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
<p><b>TABLE 1.</b> Primers used to amplify loci used for assessment of <i>Shellenius serratus</i> <b>sp. nov.</b> and corresponding annealing temperatures and extension times.</p><table><tbody><tr><th>Primer Name</th><th>Gene</th><th>Sequence (5’→3’)</th><th>Annealing</th><th>Extension</th><th>Reference</th></tr></tbody><tbody><tr><th>LCO1490 HCO2198</th><td>COI</td><td>GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA</td><td>40˚C</td><td>1 min. 30 sec.</td><td>Folmer <i>et al.</i> 1994</td></tr><tr><th>18SACDN_F1 18SACDN_R1</th><td>18S</td><td>AGAGGGAGCCTGAGAAACG GGGCAGGGACGTAATCAAC</td><td>60˚C</td><td>1 min. 45 sec.</td><td>Bahder <i>et al.</i> 2023</td></tr><tr><th>V/Forward X/Reverse</th><td>28S</td><td>GTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC</td><td>55°C</td><td>1 min. 30 sec.</td><td>Cryan <i>et al.</i> 2000</td></tr></tbody></table>
FIGURE 1 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
FIGURE 1. Habitat and locality of Platocerella sordida sp. nov.
TABLE 3 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
<p><b>TABLE 3.</b> Biometric data for <i>Platocerella sordida</i> <b>sp. nov.</b> (in mm)</p><table><tbody><tr><th>Character</th><th>Male (<i>n</i> =3)</th></tr></tbody><tbody><tr><th>Body length with wings</th><td>6.71</td></tr><tr><th>Body length without wings</th><td>2.82</td></tr><tr><th>Forewing length</th><td>5.92</td></tr><tr><th>Vertex length</th><td>0.25</td></tr><tr><th>Vertex width—basal</th><td>0.26</td></tr><tr><th>Vertex width—distal</th><td>0.18</td></tr><tr><th>Pronotum length—midline</th><td>0.02</td></tr><tr><th>Mesonotum length—midline</th><td>0.80</td></tr><tr><th>Mesonotum width</th><td>0.94</td></tr><tr><th>Frons length</th><td>0.75</td></tr><tr><th>Frons width—dorsal</th><td>0.10</td></tr><tr><th>Frons width—frontoclypeal</th><td>0.22</td></tr><tr><th>Clypeus length</th><td>0.63</td></tr></tbody></table>
TABLE 2 in A new species of planthopper in the genus Platocerella (Hemiptera: Auchenorrhyncha: Derbidae) from palms in Costa Rica, a key to the genus and an updated molecular phylogeny of available New World Otiocerinae
<p><b>TABLE 2</b>. Representative Otiocerinae used for molecular comparisons with <i>Platocerella sordida</i> <b>sp. nov.</b>; <i>Omolicna joi</i> as subfamily outgroup (Derbinae).</p><table><tbody><tr><th>Locus</th></tr></tbody><tbody><tr><th>Species</th><td>COI</td><td>18S</td><td>28S</td></tr><tr><th><i>Anotia cerebro</i></th><td>OR418164</td><td>OR419691</td><td>OR050637</td></tr><tr><th><i>Anotia firebugia</i></th><td>MT084365</td><td>MT945942</td><td>OR050636</td></tr><tr><th><i>Cobacella palmensis</i></th><td>OR044883</td><td>OR041765</td><td>OR050628</td></tr><tr><th><i>Mula resonans</i></th><td>OQ473376</td><td>OQ519977</td><td>OR050635</td></tr><tr><th><i>Omolicna joi</i></th><td>KF472312</td><td>MN472753</td><td>PP379272</td></tr><tr><th><i>Patara cooki</i></th><td>MW332651</td><td>MW333024</td><td>OR050634</td></tr><tr><th><i>Patara vanduzei</i></th><td>OQ473377</td><td>OQ519977</td><td>OR050633</td></tr><tr><th><i>Platocerella sordida</i> <b>sp. nov.</b></th><td>PP693304</td><td>PP693427</td><td>PP693428</td></tr><tr><th><i>Sayiana sayi</i></th><td>OR044884</td><td>OR041766</td><td>OR050632</td></tr><tr><th><i>Shellenius ballii</i></th><td>OQ473378</td><td>OQ519976</td><td>OR050631</td></tr><tr><th><i>Shellenius schellenbergii</i></th><td>OQ473379</td><td>OQ519975</td><td>OR050630</td></tr><tr><th><i>Shellenius serratus</i></th><td>OQ473380</td><td>OQ519974</td><td>OR050629</td></tr><tr><th><i>Sikaiana harti</i></th><td>OR418165</td><td>OR419691</td><td>OR419689</td></tr></tbody></table>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.