Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

101

datasets available to search

ShareScore release 0.9.0

Dataset results

101 results for “RNA decay”

Learn how ShareScore rates datasets ↗

zenodo44/100

Additional Data: Poised PABP-RNA hubs implement signal-dependent mRNA decay in development

This repository contains processed data resulting from iCLIP experiments that were analysed in the following paper:"Poised PABP-RNA hubs implement signal-dependent mRNA decay in development" The paper is published at Nature Structural and Molecular BIology. <h2> Archived data</h2> Data archived in this repository include: <ol> <li>Data derived from iCLIP experiments targeting LIN28A, PABPC1, and PABPC4, that were analysed in the manuscript (see iCLIP.zip). Raw data is available from ENA, with the accession code PRJEB60519. <ol> <li>Sample descriptions are given in iCLIP-SampleAnnotation.csv</li> <li>Crosslink files in BED6 format (individual replicates and merged replicates)</li> <li>Peak files generated with the Clippy peak caller in BED6 format</li> <li>K-mer enrichment around high-confidence crosslink sites in the 3'-UTRs, calculated by the PEKA software</li> </ol> </li> <li>Expression values (salmon quantfiles)  for 3'-seq experiments, specified in "QuantseqExperimentsAnnotation.tsv", are available in "SalmonQuantfiles.zip". Raw data is available from ENA, with the accession code PRJEB60519.</li> <li>Source code of the nextflow pipeline, which was used on the iMaps webserver to analyse iCLIP data and produce the files archived here (see imaps-nf-0.30.zip).</li> <li>A list of naive genes, that were analysed in the manuscript (see NaiveGeneIds.csv).</li> </ol> <h2>Details on iCLIP data generation</h2> iCLIP data for LIN28A-WT (in 2iL and FGF2 treated cells), LIN28A-S200A (in FGF2 treated cells) as well as for PABPC1 and PABPC4 (in LIN28A KO cells with and without LIN28A overexpression), were analysed on iMaps Goodwright server (<a href="https://imaps.goodwright.com/">https://imaps.goodwright.com/</a>). The LIN28A iCLIPs were analysed on 18th of July, 2022; the PABPC iCLIPs were analysed on 26th of December, 2022. The code and settings used in the pipeline (release v0.30) can be viewed at <a href="https://github.com/goodwright/imaps-nf">https://github.com/goodwright/imaps-nf </a>, and is also archived here - (imaps-nf-0.30.zip)   <ul> <li>First, reads were demultiplexed using Ultraplex and barcodes were trimmed from the reads. The default Ultraplex settings were applied, as denoted below:</li> </ul> <blockquote> adapter='AGATCGGAAGAGCGGTTCAG' adapter2='AGATCGGAAGAGCGTCGTG' barcodes='barcode.csv', final_min_length=20 fiveprimemismatches=1 ignore_no_match=False ignore_space_warning=False inputfastq='MOD4878A1-merged.fastq.gz', keep_barcode=False, min_trim=3, outputprefix='demux', phredquality=30, phredquality_5_prime=0, sbatchcompression=False, threads=10, threeprimemismatches=0, ultra=False </blockquote>   <ul> <li>TrimGalore was used to run FASTQC and quality trim the reads and remove reads with length less than 10 nt:</li> </ul> <blockquote> trim_galore --fastqc --length 10 -q 20 --cores 8 --gzip file.fastq.gz </blockquote>   <ul> <li>Reads were then premapped to rRNA, tRNA sequences referred to as small RNA, smRNA, using mouse genome build (GRCm39 GENCODE M28 annotation) with Bowtie v1.3.0 (Langmead et al., 2009)</li> </ul> <blockquote> bowtie --threads 12 --sam -x $INDEX -q --un file.unmapped.fastq -v 2 -m 100 --norc --best --strata file.fq.gz 2 </blockquote>   <ul> <li>Reads that did not map with Bowtie were then aligned with STAR v2.7.9a (Dobin et al., 2013) to mouse genome build (GRCm39 GENCODE M28 annotation).</li> </ul> <blockquote> STAR \ --genomeDir star \ --readFilesIn file.unmapped.fastq.gz \ --runThreadN 12 \ --outFileNamePrefix 1_R1. \ \ --sjdbGTFfile Homo_sapiens_filtered.gtf \ --outSAMattrRGline 'ID:1_R1' 'SM:1_R1' \  --readFilesCommand zcat --outSAMtype BAM SortedByCoordinate --quantMode TranscriptomeSAM --outFilterMultimapNmax 1 --outFilterMultimapScoreRange 1 --outSAMattributes All --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterType BySJout --alignIntronMin 20 --alignIntronMax 1000000 --outFilterScoreMin 10 --alignEndsType Extend5pOfRead1 --twopassMode Basic </blockquote>   <ul> <li>PCR-duplicates were removed using UMI-tools (Smith, Heger and Sudbery, 2017)</li> </ul> <blockquote> java -jar /UMICollapse/umicollapse.jar \   bam \   -i file.Aligned.sortedByCoord.out.bam \   -o file.dedup.bam \   --umi-sep rbc: </blockquote>   <ul> <li>The nucleotide preceding each sequencing read was assigned as the crosslink event.</li> </ul>   <ul> <li>Peaks of crosslinking signal were identified with Clippy v1.4.1, using the default settings.</li> </ul>   <ul> <li>Obtained peaks and crosslink sites were used to run PEKA v1.0.0 (Kuret et al., 2022), using the default settings.</li> </ul>   <ul> <li>For Clippy and PEKA, the GENCODE primary assembly annotation M28 was filtered to retain only entries with transcript support level 1 or 2, in genes where such transcripts were available, and used to produce a segmentation file with the get_segments function from the iCount tool (Curk, 2019).</li> </ul>   <ul> <li>All files generated during data processing are available from the iMaps Goodwright webserver for analysis of CLIP data (see <a href="https://imaps.goodwright.com/collections/882635250203/">https://imaps.goodwright.com/collections/882635250203/</a> and <a href="https://imaps.goodwright.com/collections/340215254997/">https://imaps.goodwright.com/collections/340215254997/</a> for LIN28A and PABPC1/4 iCLIPs, respectively).</li> </ul> <h2>Source data</h2> Raw sequencing reads, from which the data enclosed here were derived, are accessible at ENA (PRJEB60519). The raw sequencing reads and all data produced by the analysis pipeline is also available at the iMaps webserver (see <a href="https://imaps.goodwright.com/collections/882635250203/">https://imaps.goodwright.com/collections/882635250203/</a> and <a href="https://imaps.goodwright.com/collections/340215254997/">https://imaps.goodwright.com/collections/340215254997/</a> for LIN28A and PABPC1/4 iCLIPs, respectively); and on the updated Flow webserver (see <a href="https://app.flow.bio/projects/882635250203/">https://app.flow.bio/projects/882635250203/</a> and <a href="https://app.flow.bio/projects/340215254997/">https://app.flow.bio/projects/340215254997/ </a>for LIN28A and PABPC1/4 iCLIPs, respectively). <h2>Downstream computational analysis of enclosed data</h2> The code, used to analyse the data enclosed here and train the CNN to predict transcript stability in naive-to-primed transition based on 3'UTR nucleotide sequence, is available at GitHub (<a href="https://github.com/ulelab/LIN28A_RNPreassembly_bioinformatics">https://github.com/ulelab/LIN28A_RNPreassembly_bioinformatics</a>) and archived on Zenodo (<a href="../doi/10.5281/zenodo.10054297">https://zenodo.org/doi/10.5281/zenodo.10054297</a>).

Find research datasets worth reusing

Dataset results

Additional Data: Poised PABP-RNA hubs implement signal-dependent mRNA decay in development

Differential Gene Expression and mRNA decay in Wild-Type and Myeloid-specific TTP Knock-out macrophages using RNA-Seq

Sodium fluoride exposure leads to ATP depletion and altered RNA decay in Escherichia coli under anaerobic conditions

Small-molecule Inhibition of METTL3 Suppresses Tumor Growth and Promotes Neuroblastoma Differentiation [RNA-Seq Decay]

RNA decay defines the therapeutic response to transcriptional perturbation in leukemia [SLAMseq THP1 RNAPII targeting]

Nonsense-Mediated Decay restricts lncRNAs levels in yeast unless blocked by double-stranded RNA structure

Global decay of regulatory chromatin architecture promotes rebalancing of gene expression during colorectal cancer development [RNA-seq II]

Aging drives a program of DNA methylation decay in plant organs [RNA-Seq]

4EHP and GIGYF1/2 induce translation-coupled messenger RNA decay

MYC induces oncogenic stress through RNA decay and ribonucleotide catabolism

Compromised nonsense-mediated RNA decay results in truncated RNA-binding protein production upon DUX4 expression

RNA decay defines the therapeutic response to transcriptional perturbation in leukemia [SLAMseq K562 RNAPII targeting]

Expression of subtelomeric lncRNAs links telomeres maintenance with RNA decay in S. cerevisiae

RNA sequencing identifies novel regulated IRE1-dependent decay targets that affect multiple myeloma survival and proliferation

RNA sequencing of blastocyst-stage mouse embryos in the presence or absence of RNA decay activator UPF2

LSM2-8 and XRN-2 contribute to the silencing of H3K27me3 marked genes through targeted RNA decay II

RNA decay defines the therapeutic response to transcriptional perturbation in leukemia [TotalRNAseq K562 MYC clones]

Human Nonsense-Mediated RNA Decay Initiates Widely by Endonucleolysis and Targets snoRNA Host Genes

The Nonstop decay and the RNA silencing systems operate cooperatively in plants

A nuclear export block triggers the decay of newly synthesized polyadenylated RNA

Understand access before you commit

Allen Brain Atlas

Annotated Behaviour and Observability Dataset (ABODe)

DANDI Archive for NWB datasets

International Brain Laboratory public data

OpenNeuro