Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
62
datasets available to search
ShareScore release 0.9.0
Dataset results
62 results for “faeces”
FIGURE 5 in Hidden subsurface garden on own faeces - the trace fossil Tubulichnium rectum (Fischer-Ooster, 1858) from the Cretaceous-Palaeogene deep-sea sediments
FIGURE 5. Macroscopic and microscopic and SEM observations of Tubulichnium rectum (Fischer-Ooster, 1858) occurring in turbiditic sandstones of the Inoceramian Beds (Upper Cretaceous–Paleocene), Słopnice, Poland (1, 4-8) and turbiditic marls of the Pagliaro Formation (Paleocene), Italy (2, 3): 1, specimen with elevated edges and bent down roof as seen on upper bedding surface (INGUJ144P195); 2, 3, depressions of pellets in the burrow margin after pellets have been partly or completely removed (INGUJ196P36 and 38); 4, photomicrograph of transverse cross-section; note deformed laminae above the collapsed burrow; 5, 6, burrow margin showing depressions of pellets that have been removed by weathering; 7, part of split pellets in place consisting of clay minerals and siliciclastic silt grains; 8, outer part of a split pellet showing platy minerals oriented ±parallel to surface.
FIGURE 4 in Hidden subsurface garden on own faeces - the trace fossil Tubulichnium rectum (Fischer-Ooster, 1858) from the Cretaceous-Palaeogene deep-sea sediments
FIGURE 4. Tubulichnium rectum (Fischer-Ooster, 1858) on the lower bedding surfaces (1-3) of and in longitudinal (4) and transverse (5-10) cross-sections of turbiditic sandstones from the Inoceramian Beds (Upper-Cretaceous-Paleocene) at Słopnice: 1, note external and internal parts INGUJ144P176; 2, note sandy mantle covering the pelleted part, INGUJ144P193a, 3, note wrinkles on the mantle, INGUJ144P187a; 4, longitudinal cross section (Tr), INGUJ144P193; 5-10, transverse sections, E – INGUJ144P182d, F – INGUJ144P180, G – INGUJ144P192b, H – INGUJ144P170a, I – INGUJ144P190, J – INGUJ144P192c, K – INGUJ144P192.
FIGURE 3 in Hidden subsurface garden on own faeces - the trace fossil Tubulichnium rectum (Fischer-Ooster, 1858) from the Cretaceous-Palaeogene deep-sea sediments
FIGURE 3. Tubulichnium rectum (Fischer-Ooster, 1858) on upper bedding surfaces from different formations: 1, on the upper surface of turbiditic marl with Chondrites intricatus (Chi), Pagliaro Formation (Paleocene), Cabella Ligure, Northern Apennines, Italy, field photograph; 2, curved example of T. rectum (Tr), Scolicia isp. (Sc) and Phycosiphon incertum (Ph), Ropianka Formation (Upper Cretaceous), Wara, Skole Nappe, Carpathians, Poland, UJTF 1426, Książkiewicz collection; 3, several specimens of T. rectum (Tr), some cross cut by Chondrites intricatus (Chi), Pagliaro Formation (Paleocene), Cabella Ligure, Northern Apennines, Italy, field photograph; 4, specimen with two (1, 2) superimposed pellet pavements. Inoceramian Beds (Upper Cretaceous-Paleocene), Słopnice, INGUJ144P190a; 5; specimens with elevated edges and collapsed roof, Inoceramian Beds (Upper Cretaceous-Paleocene), Słopnice, INGUJ144P140; 6, example of spindle-shaped burrow enlargement, Pagliaro Formation (Paleocene), Cabella Ligure, Northern Apennines, Italy, field photograph; 7, T. rectum cut by Ophiomorpha annulata (Oa), Inoceramian Beds (Upper Cretaceous-Paleocene), Słopnice, INGUJ143P66.
FIGURE 6 in Hidden subsurface garden on own faeces - the trace fossil Tubulichnium rectum (Fischer-Ooster, 1858) from the Cretaceous-Palaeogene deep-sea sediments
FIGURE 6. Short sections showing position of Tubulichnium rectum and associated traces fossils in strata of the Ropianka Formation (Inoceramian Beds) at Słopnice, Magura Nappe, Carpathians, Poland. GPS coordinates: section A: 49°42.982'N, 020°20.448'E; section B: 49°42.974'N, 20°20.453'E, section C: 49°42.610'N, 20°20.687'E.
FIGURE 7 in Hidden subsurface garden on own faeces - the trace fossil Tubulichnium rectum (Fischer-Ooster, 1858) from the Cretaceous-Palaeogene deep-sea sediments
FIGURE 7. Stratigraphic range of Tubulichnium rectum (Fischer-Ooster, 1858) and number of formations per stage in which it occurs.
FIGURE 1 in Hidden subsurface garden on own faeces - the trace fossil Tubulichnium rectum (Fischer-Ooster, 1858) from the Cretaceous-Palaeogene deep-sea sediments
FIGURE 1. Location maps: 1, a part of Europe with main localities of the material studied and indication of the main study area in the Polish Carpathians; 2, the main study area in the Polish Carpathians with indication of several localities of the material studied or reported occurrences of Tubulichnium rectum.
FIGURE 2 in Hidden subsurface garden on own faeces - the trace fossil Tubulichnium rectum (Fischer-Ooster, 1858) from the Cretaceous-Palaeogene deep-sea sediments
FIGURE 2. Holotype of Tubulichnium rectum (Fischer-Ooster, 1858) and some other key specimens described by Fischer-Ooster (1858) and Książkiewicz (1977), which are housed in the Naturhistorisches Museum der Burgergemeinde Bern (NMBE) in Switzerland and in the Nature Education Centre of the Jagiellonian University – Museum of Geology, Kraków, Poland, respectively: 1, holotype, originally Halymenites rectus Fischer-Ooster and Chondrites targionii (Cht), Gurnigel Flysch (Maastrichtian), Seeligraben near Gurnigelbad (Switzerland), specimen NMBE 5017471. Detail illustrated in 2 marked by the quadrangle; 2, detail of 1; 3, original of Halymenites minor Fischer-Ooster, 1858 and Chondrites intricatus (Chi) from Gurnigel Flysch (Maastrichtian), Seeligraben near Gurnigelbad (Switzerland), specimen NMBE 5017474; 4, original of Halymenites incrassatus Fischer-Ooster, 1858, Fähnernspitz, Upper Cretaceous, E Switzerland, specimen NMBE 5017470; 5, holotype of Tubulichnium incertum Książkiewicz, 1977 (yellow arrow), other specimen of the same ichnotaxon (Tr) and Scolicia vertebralis (Sv); Ropianka Formation (Inoceramian Beds), Upper Cretaceous-Paleocene, Bachów, Skole Nappe, specimen UJTF 938; 6, detail of 5 showing the holotype.
[Dataset] Pattern and repeatability of ascarid-specific antigen excretion through chicken faeces, and the diagnostic accuracy of copro-antigen measurements as compared with McMaster egg counts and plasma and egg yolk antibody measurements in laying hens
<p>Comprehensive data examining the pattern and repeatability of ascarid-specific antigen excretion in chicken faeces and the diagnostic accuracy of copro-antigen measurements compared to McMaster egg counts and antibody measurements in laying hens.</p> <p>The dataset consists of observations and measurements obtained from a controlled study involving laying hens infected with mixed <em>Ascaridia galli</em> and<em> Heterakis gallinarum</em>. A total of 179 individual hens were monitored between wpi 2 and 18 and their fecal samples/blood samples were collected at specific time points. Faecel samples were repeatedly collected four(4) consecutive times in one wpi.Hence antigen measurements is 4 X 179 = 716 measurements</p>
Dataset for "Spectroscopic investigation of faeces with surface-enhanced Raman scattering: a case study with coeliac patients on gluten-free diet"
<p>This dataset contains all the spectra and OTU table data used in the paper "Spectroscopic investigation of faeces with surface-enhanced Raman scattering: a case study with coeliac patients on gluten-free diet", plus the R code to import the TXT (ASCII) files into a dataset, preprocess data, analzye data and generate the figures shown in the paper.</p> <p>Spectral data are available in 2 different format:</p> <p>- the original TXT files (as generated from the Raman instrument, 1 file = 1 spectrum)</p> <p>- as RData file (an hyperSpec object including metadata), directly to be opened in R</p> <p>The OTU table is available either as a single XLSX file or as a RData file to be opened in R.</p> <p>The R code used to generate the figures is available as a single file "Rcode.R".</p>
Dietary adaptations along the Northern limit of distribution: What does the smooth snake (Coronella austriaca) eat in Norway? Metabarcoding of stomach content and visual analysis of faeces
Open the record for dataset details and reuse information.
Data from: Litter conversion into detritivore faeces reshuffles the quality control over C and N dynamics during decomposition
1. In many terrestrial ecosystems, detritivorous soil organisms ingest large amounts of leaf litter returning most of it to the soil as faeces. Such conversion of leaf litter into faeces may stimulate decomposition by increasing the surface area available for microbial colonization. Yet, experimental support for either the outcome or the mechanism of these conversion effects is lacking. 2. Based on the hypothesis that the identity of plant species from which leaf litter is transformed into faeces has a critical role in how faeces decomposition proceeds, we collected faeces of the widely abundant millipede Glomeris marginata fed with leaf litter from seven distinct tree species. We compared the physical and chemical characteristics and the rates of carbon (C) and nitrogen (N) loss between litter and faeces. 3. We found that after 100 days of exposure under controlled conditions, C loss was on average higher in faeces (40%) than in litter (26.6%), with a significant increase for six out of the seven species. Concurrently, N dynamics switched from a net immobilisation (7.7%) in litter to a net release (14.6%) in faeces, with a significant increase for five out of the seven species. 4. Litter conversion into faeces generally homogenised differences in physical and chemical characteristics among species. Despite such homogenisation, variability in rates of faeces C and N loss among species was similar compared to leaf litter, but correlated with a different set of traits. Specifically, faecal pellet C loss was positively related to compaction (decreased specific area and increased density of faecal pellets), and both C and N loss from faecal pellets were positively related to fragmentation (increased specific area and perimeter of particles within faecal pellets). 5. We conclude that litter fragmentation and compaction into detritivore faecal pellets leads to substantially enhanced decomposition, with a particularly strong impact on N dynamics that changed from immobilisation to net release depending on litter species. Moreover, litter quality control on decomposition is reshuffled by litter conversion into faeces. In ecosystems with high detritivore abundance, this so far largely overlooked pathway of organic matter turnover may strongly affect ecosystem C and N cycling.
Data from: Determining diet from faeces: selection of metabarcoding primers for the insectivore Pyrenean desman (Galemys pyrenaicus)
Molecular techniques allow non-invasive dietary studies from faeces, providing an invaluable tool to unveil ecological requirements of endangered or elusive species. They contribute to progress on important issues such as genomics, population genetics, dietary studies or reproductive analyses, essential knowledge for conservation biology. Nevertheless, these techniques require general methods to be tailored to the specific research objectives, as well as to substrate- and species-specific constraints. In this pilot study we test a range of available primers to optimise diet analysis from metabarcoding of faeces of a generalist aquatic insectivore, the endangered Pyrenean desman (Galemys pyrenaicus, É. Geoffroy Saint-Hilaire, 1811, Talpidae), as a step to improve the knowledge of the conservation biology of this species. Twenty-four faeces were collected in the field, DNA was extracted from them, and fragments of the standard barcode region (COI) were PCR amplified by using five primer sets (Brandon-Mong, Gillet, Leray, Meusnier and Zeale). PCR outputs were sequenced on the Illumina MiSeq platform, sequences were processed, clustered into OTUs (Operational Taxonomic Units) using UPARSE algorithm and BLASTed against the NCBI database. Although all primer sets successfully amplified their target fragments, they differed considerably in the amounts of sequence reads, rough OTUs, and taxonomically assigned OTUs. Primer sets consistently identified a few abundant prey taxa, probably representing the staple food of the Pyrenean desman. However, they differed in the less common prey groups. Overall, the combination of Gillet and Zeale primer sets were most cost-effective to identify the widest taxonomic range of prey as well as the desman itself, which could be further improved stepwise by adding sequentially the outputs of Leray, Brandon-Mong and Meusnier primers. These results are relevant for the conservation biology of this endangered species as they allow a better characterization of its food and habitat requirements.
Data from: Analysis of Australian fur seal diet by pyrosequencing prey DNA in faeces
DNA-based techniques have proven useful for defining trophic links in a variety of ecosystems and recently developed sequencing technologies provide new opportunities for dietary studies. We investigated the diet of Australian fur seals (Arctocephalus pusillus doriferus) by pyrosequencing prey DNA from faeces collected at three breeding colonies across the seals' range. DNA from 270 faecal samples was amplified with four polymerase chain reaction primer sets and a blocking primer was used to limit amplification of fur seal DNA. Pooled amplicons from each colony were sequenced using the Roche GS-FLX platform, generating > 20 000 sequences. Software was developed to sort and group similar sequences. A total of 54 bony fish, 4 cartilaginous fish and 4 cephalopods were identified based on the most taxonomically informative amplicons sequenced (mitochondrial 16S). The prevalence of sequences from redbait (Emmelichthys nitidus) and jack mackerel (Trachurus declivis) confirm the importance of these species in the seals' diet. A third fish species, blue mackerel (Scomber australasicus), may be a more important prey species than previously recognised. There were major differences in the proportions of prey DNA recovered in faeces from different colonies, probably reflecting differences in prey availability. Parallel hard-part analysis identified largely the same main prey species as did the DNA-based technique, but with lower species diversity and no remains from cartilaginous prey. The pyrosequencing approach presented significantly expands the capabilities of DNA-based methods of dietary analysis and is suitable for large-scale diet investigations on a broad range of animals.
FIGURES 16–19. 16–18 in A further new species of Sarcofahrtiopsis Hall (Diptera: Sarcophagidae) associated with faeces of the disk-winged bat (Thyroptera Spix: Chiroptera) in Brazil and the redescription of the female terminalia of S. cuneata (Townsend)
FIGURES 16–19. 16–18. Puparium of Tricharaea spp. 16–17. Tricharaea (Sarcophagula) occidua (Fabricius). 16. Detail of cuticle, dorsal view. Scale bar = 100 µm. 17. Anal division, posterior view. Scale bar = 30 µm. 18. Tricharaea (Sarothromyia) femoralis (Schiner). Anal division, posterior view. Scale bar = 300 µm. 19. Sarcofahrtiopsis cupendipe sp. nov. Female, habitus lateral. Scale bar = 1 mm.
FIGURES 8–15 in A further new species of Sarcofahrtiopsis Hall (Diptera: Sarcophagidae) associated with faeces of the disk-winged bat (Thyroptera Spix: Chiroptera) in Brazil and the redescription of the female terminalia of S. cuneata (Townsend)
FIGURES 8–15. Puparium of Sarcofahrtiopsis cupendipe sp. nov. 8. Dorsal view. Scale bar = 0.5 mm. 9. Cavity of the anal division, posterior view. Scale bar = 0.5 mm. 10. Detached upper front piece, dorsal view. Scale bar = 100 µm. 11. Anterior spiracle. Scale bar = 20 µm. 12. Detached lower front piece, ventral view. Scale bar = 100 µm. 13. Posterior spiracle. Scale bar = 40 µm. 14. Lateral piles of thoracic segments, dorsolateral view. Scale bar = 100 µm. 15. Dorsomedian crest of anal division, dorsal view. Scale bar = 100 µm. (Abbreviations: ct = crest; pp = postanal process; sh = spiracular hair; ss = spiracular slit; tp = triangular process).
FIGURES 1–5 in A further new species of Sarcofahrtiopsis Hall (Diptera: Sarcophagidae) associated with faeces of the disk-winged bat (Thyroptera Spix: Chiroptera) in Brazil and the redescription of the female terminalia of S. cuneata (Townsend)
FIGURES 1–5. Sarcofahrtiopsis cupendipe sp. nov., male holotype. 1. Epandrium, surstylus and cercus, left lateral view. 2. Cerci, posterior view. 3. Right pregonite, postgonite and postgonal apodeme, lateral view. 4. Sternite 5. 5. Phallus, lateral view. Scale bars = 0.1 mm, except in Fig. 4 where it represents 0.3 mm. (Abbreviations: ap = postgonal apodeme; bp = basiphallus; dp = distiphallus; prg = pregonite; ptg = postgonite; ls = lateral stylus; ms = median stylus; sb = stylar base; ve = vesica).
FIGURES 6–7. Female terminalia, posterior view. 6 in A further new species of Sarcofahrtiopsis Hall (Diptera: Sarcophagidae) associated with faeces of the disk-winged bat (Thyroptera Spix: Chiroptera) in Brazil and the redescription of the female terminalia of S. cuneata (Townsend)
FIGURES 6–7. Female terminalia, posterior view. 6. Sarcofahrtiopsis cupendipe sp. nov., paratype. 7. Sarcofahrtiopsis cuneata (Townsend). Scale bars = 0.3 mm. (Abbreviations: ce = cercus; hy = hypoproct; sp = spiracle; spm = spermatheca; St = sternite; T = tergite; vp = vaginal plate).
Fig. 1 in Blautia argi sp. nov., a new anaerobic bacterium isolated from dog faeces
Fig. 1. Phylogenetic consensus tree based on 16S rRNA gene sequences, reconstructed with the neighbour-joining (NJ), maximumparsimony (MP) and maximum-likelihood (ML) algorithms, indicating the taxonomic positions of isolates and close relatives. Bootstrap values (>70 %, NJ/MP/ML) calculated for 1000 subsets are shown at branch nodes. Atopobium minutum served as an outgroup. Bar, 0.02 subsitutions per nucleotide position.
Supplementary material 1 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 1: Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.
Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.