Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

datasets available to search

ShareScore release 0.9.0

Dataset results

62 results for “foot disease”

Learn how ShareScore rates datasets ↗

zenodo40/100

Identifying the Fusarium species involved in foot rot disease of beans in the UK using a combined molecular and microbiological approach

Materials and methods Fungal isolation Isolates (113) were prepared from both soil and infected plant samples that were received from the Plant Clinic at the Processors and Growers Research Organisation (PGRO). The samples were from different regions of England, United Kingdom (Table 1). <a name="_Ref165642771"></a>Table 1: The locations and number of isolates obtained for infected faba bean and soil samples used in the study. * = includes soil isolates <table> <tbody> <tr> <td> Location </td> <td> Number of isolates obtained </td> <td> Month(s) </td> </tr> <tr> <td> PGRO experimental plots </td> <td> 29* (13 soil, 16 plant) </td> <td> November 2022 </td> </tr> <tr> <td> Cambridgeshire </td> <td> 2 </td> <td> June 2023 </td> </tr> <tr> <td> Oxfordshire </td> <td> 3 </td> <td> June-July 2023 </td> </tr> <tr> <td> Durham </td> <td> 3 </td> <td> July 2023 </td> </tr> <tr> <td> Shropshire </td> <td> 4 </td> <td> July and August2023 </td> </tr> <tr> <td> Lincolnshire </td> <td> 5 </td> <td> July and August 2023 </td> </tr> <tr> <td> Northumberland </td> <td> 5 </td> <td> July and August 2023 </td> </tr> <tr> <td> Staffordshire </td> <td> 4 </td> <td> July  and August 2023 </td> </tr> <tr> <td> Suffolk </td> <td> 4 </td> <td> July 2023 </td> </tr> <tr> <td> Leicestershire </td> <td> 2 </td> <td> July 2023 </td> </tr> <tr> <td> Essex </td> <td> 4 </td> <td> July 2023 </td> </tr> <tr> <td> Norfolk </td> <td> 34 </td> <td> August 2023 </td> </tr> <tr> <td> Yorkshire </td> <td> 6 </td> <td> September 2023 </td> </tr> <tr> <td> Hampshire </td> <td> 2 </td> <td> July 2023 </td> </tr> <tr> <td> Undisclosed PGRO locations </td> <td> 6 </td> <td> Undisclosed </td> </tr> </tbody> </table>   Infected plant samples were disinfected by placing pieces of infected stems/root in 10 % sodium hypochlorite solution for 5 min. The samples were rinsed twice using sterilised distilled water and placed on sterilised filter paper to be dried for 10 min at room temperature inside a laminar flow hood. The dried samples were moved to potato dextrose agar medium (PDA) inside 9 cm diameter plastic Petri dishes. Petri dishes were incubated at 22<a name="_Hlk134433128"></a> °C with 12 h fluorescent photoperiod, <a name="_Hlk165887610"></a>and light intensity of 20-25 µMol.m-2.s-1. Once colonies had formed, clonal isolates were prepared from the colonies as follows. Approximately 1 mm2 of the colony was collected using a flame-sterilised inoculation loop and was sequentially spread onto three Petri dishes containing 2 % water agar, to dilute the inoculum gradually. The Petri dishes were incubated for 24 h as described above. The third Petri dish for each isolate was examined under a stereoscope, and one separated hypha was transferred using a flame-sterilised scalpel to another Petri dish containing PDA medium, and incubated for seven days to provide a clonal isolate. The isolates were stored for future use using two methods, for routine or long-term storage. For routine storage (months), three discs of the PDA medium containing the clonal isolate were transferred to a 2 ml microcentrifuge tube containing 1 ml of sterilised distilled water, the tube sealed with parafilm and stored at -20 °C. For long-term storage (3-4 years) the clonal isolate was plated onto a Petri dish containing many pieces of 1 cm long sterilised filter paper on PDA medium, and the colony was allowed to grow for seven days to cover the filter paper. The pieces of filter paper were removed and placed inside an empty Petri dish and dried for seven days at room temperature. The filter paper pieces were then transferred to an empty 2 ml plastic microcentrifuge tube and stored at -20 °C. Koch`s postulates were confirmed for each of the isolates by re-isolation, inoculation, and identification.   Pathogenicity testing Pathogenicity testing was conducted using susceptible faba bean seedlings (cv. Lynx) grown in test tubes in a mixture of perlite/vermiculite. The growth media was prepared by adding one volume of vermiculite (the capacity of a 1000 ml plastic beaker) to one volume of perlite inside an autoclave bag; this was mixed to ensure equal distribution of each component, and 1 litre of distilled water was added. The autoclave bag was closed and autoclaved for 20 min at 121 °C, and the mixture was transferred to fill 2/3 of the test tubes (150 x 24 mm, 1.2 ml wall; borosilicate glass 150 x 24 mm, rimless, Appleton Woods Ltd), which were then sealed with cotton wool and aluminium foil, prior to being autoclaved. Seeds were soaked in sterilized distilled water overnight and placed in 10 % sodium hypochlorite for 5 min. The seeds were washed three times with sterilised distilled water and placed on sterilised filter paper until dry. The seeds were then transferred to 9 cm petri dishes containing 1.2 % Tap Water Agar (12 g agar in 1 l of tap water, autoclaved in a 2 l conical flask), where they were allowed to germinate for four days in the incubator at 24 °C before being transferred to test tubes containing the vermiculite/perlite mixture. Following transfer, the seedlings were allowed to grow for five to seven days until they were suitable for inoculation (4-5 cm root length). The seedlings were inoculated by placing a 10 mm block of PDA medium containing a ten-day old fungal culture against the stem base. A small piece of sterilised cotton was placed around the stem to ensure adequate moisture at the inoculation site. The inoculated seedlings were incubated at 24 °C, with a 12 h photoperiod and light intensity of 20-25 µMol.m-2.s-1. Disease severity was monitored daily from 5-6 days after inoculation. Root and stem infection were scored on days 15 and 25 using a 5-point scale (Figure 2): 0 = healthy roots, no discolouration. 1 = up to 20 % root or stem base discoloured. 2 = 20-40 % root or stem base discoloured. 3 = 40-60 % root or stem base discoloured. 4 = 60-80 % root or stem base discoloured, stunting of plant. 5 = total discoloration, dead plant. DNA extraction Clonal colonies were cultured on 50 ml of Potato Dextrose Broth (PDB) medium (FORMEDIUMTM) in a 250 ml flask and incubated for seven days on a rotary shaker (22 °C with 70 RPM). The mycelium for each isolate was harvested by transferring the contents of each flask into a 50 ml falcon tube and centrifuging at 5000 RPM for 10 min. The supernatant was discarded, and the mycelium pellet stored at -20 °C. Mycelium (1 ml) was transferred to a 2 ml safe-lock microcentrifuge tube. The tubes were covered with parafilm which was pierced to allow moisture to evaporate. Samples were freeze-dried (-45 °C, 0.133 mbar) for 48 h. Freeze-dried mycelium (15 mg) was transferred to a 2 ml safe lock microcentrifuge tube containing two carbon steel ball bearings (3 mm diameter, grade 1000, SimplyBearings). The mycelium was homogenised for 4 min using a TissueLyser (Retsch MM400; 30 RPS), after which 120 µl of TNES buffer was added and the samples were homogenised again as before. Total DNA was extracted from the samples following the BOMB-Bio nucleic acid tissue DNA extraction protocol (Oberacker et al., 2019). The samples were incubated at 55 °C overnight after adding 2 µl of proteinase K and 3 µl of RNAase A. Following incubation, 240 µl of GITC lysis buffer was added, mixed and samples incubated at room temperature for 5 min. Isopropanol (480 µl) was added and, following centrifugation (5000 RPM; 5 min), 650 µl was transferred to a new tube with 200 µl of 1X BOMB-Bio magnetic bead solution (1:50 carboxylated SeraMag Speed Beads magnetic beads in TE) and mixed. The solution was placed on a magnetic rack to hold the beads with DNA bound to them in place whilst the supernatant was removed. The beads with bound DNA were washed once with isopropanol (400 µl) and twice with 80 % ethanol (400 µl). The solution was removed from the magnet, beads were allowed to dry briefly and 70 µl of nuclease free water was added to elute the DNA. The beads were removed by placing the samples back on the magnetic rack and transferring the supernatant to a new tube. The extracted DNA concentration was estimated using a Qubit 4 and 1X dsDNA High Sensitivity (HS) Assay Kit (Invitrogen) according to the manufacturer’s instructions. Polymerase Chain Reaction (PCR) DNA was amplified using PCR with three sets of primers: Internal Transcribed Spacer (ITS) primers ITS1/ITS4 (Raja et al., 2017) and two sets of Translation Elongation Factor one α primers, 1018F/1620R and EF1/EF2 (O’Donnell et al., 1998; Raja et al., 2017). Prior to PCR, the template DNA concentration was adjusted to<a name="_Hlk133674492"></a> 5 ng/μl using molecular grade water. The PCR mix <a name="_Hlk133674557"></a>contained: 12.5 µl of 2x MyTaq Red Mix (Meridian Bioscience), 3 µl of template DNA, 1 µl of each primer (10 µM) and 7.5 µl of nuclease free water to a final volume of 25 µl. The cycling conditions and sequence of each primer are given in Table 2. The PCR products were separated alongside a 1 kbp ladder (GeneRuler 1 kb Plus DNA Ladder Thermo scientific SM1331) using gel electrophoresis in a 1 % agarose gel in TAE buffer stained with GelRed® nucleic acid stain (Sigma Aldrich). Gels were visualised with a UV transilluminator (BioRad) to confirm successful amplification. <a name="_Ref162427061"></a>Table 2: The ITS (ITS1 and ITS4) and TEF1α (1018F, 1620R, EF1 and EF2) primer sequences and PCR conditions. <table> <tbody> <tr> <td> Primer </td> <td> Sequence (5’-3’) </td> <td> Initial Melt </td> <td> Melt </td> <td> Anneal </td> <td> Extension </td> <td> Final extension </td> </tr> <tr> <td> ITS1: ITS4:  (Raja et al., 2017) </td> <td> CGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC </td> <td> 94 °C 5 min </td> <td> 94°C 30 sec </td> <td> 55 °C 1 min </td> <td> 72 °C 2 min </td> <td> 72 °C 7 min </td> </tr> <tr> <td> 35 cycles </td> </tr> <tr> <td> 1018F: 1620R: (O’Donnell et al., 1998; Raja et al., 2017) </td> <td> GAYTTCATCAAGAACATGAT GACGTTGAADCCRACRTTGTC </td> <td> 94 °C 5 min   </td> <td> 94 °C 30 sec </td> <td> Touch down 66-56 °C 1 min   </td> <td> 72 °C 1 min </td> <td> 72 °C 10 min </td> </tr> <tr> <td> 9 cycles </td> </tr> <tr> <td> 94 °C 30 sec </td> <td> 56 °C 1 min   </td> <td> 72 °C 1 min </td> </tr> <tr> <td> Remaining 26 cycles </td> </tr> <tr> <td> EF1: EF2: (O’Donnell et al., 1998) (Raja et al., 2017) </td> <td> ATGGGTAAGGARGACAAGAC GGARGTACCAGT SATCATGTT   </td> <td> 95 °C 2 min </td> <td> 95 °C 30 sec </td> <td> 54.1 °C 1 min </td> <td> 72 °C 1 min </td> <td> 72 °C 5 min </td> </tr> <tr> <td> 35 cycles </td> </tr> <tr> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> <td> </td> </tr> </tbody> </table>   Prior to sequencing, the PCR products were purified using solid-phase reversible immobilisation (SPRI) magnetic beads. To each PCR product, 1 X SPRI beads were added at a 1:2 ratio of PCR product to bead solution (50 µl PCR product to 100 µl SPRI beads) and the mixture incubated for 5 min at room temperature. The tubes were transferred to the magnetic plate for 5 min until the solution was clear, at which point the supernatant was discarded and the beads were washed twice with 80% ethanol for 60 s each time. Ethanol was removed and the beads held on the magnetic plate were allowed to dry for 5-10 min at room temperature. The tubes containing the dry beads were removed from the magnetic plate, and 50 µl of molecular grade nuclease free water was added to each tube, mixed and incubated for 5 min, allowing the DNA to elute. The tubes were placed back on the magnetic plate for 5 min until the solution was clear, at which point the supernatant was transferred to a new 1.5 ml microcentrifuge tube. Sanger sequencing was carried out using ITS1, ITS4 primers and EF1, EF2 primers. All sequencing was carried out by Eurofins Genomics. Following sequencing, the chromatograms obtained were trimmed and analysed using Geneious Prime (version 2023.0.4). First, low-quality bases (e.g., overlapping peaks) were trimmed from each end and the sequence upstream from that site, including the primer sequence, was deleted. The forward and reverse sequence for each sample were assembled using the de novo assemble function in Geneious at the highest sensitivity to create a consensus sequence (highest threshold quality: 60%). A basic local alignment search tool (BLAST) search was carried out for the consensus sequences using the NCBI-NR database for the ITS sequences, and, for the TEF1α sequences, the data available on the Fusarium ID database (Torres-Cruz et al., 2022). All of the TEF1α consensus sequences from all samples were subsequently aligned with the available sequences on the Fusarium ID database (Geneious global alignment with free end gaps, 65% similarity), and a phylogenetic tree was generated (genetic distance model Tamura-Nei, neighbour joining method, bootstrap with 100 replicates).

opencc-by-4.0Oct 2024View details →

dryad40/100

Statistical analysis code for output from a model used to simulate foot-and-mouth disease dynamics in the United Kingdom

Epidemics can sometimes be managed through reductions of host density, such as social distancing for human diseases, reducing plant density through cultural and genetic means, and host culling for epizootics. These approaches allow for a certain density of hosts to remain within a targeted area. By contrast, total ring depopulation is often used as a management strategy for emerging infectious diseases in livestock. In this study, we explore the trade-offs of a density-based culling strategy to determine if fewer livestock farms can be culled within rings while maintaining a decrease in disease transmission. To do so, we evaluated a farm-density-based ring culling strategy to control foot-and-mouth disease (FMD) in the United Kingdom. This strategy may allow for some farms within rings around infected premises (IPs) to escape depopulation, with the aim to prevent over-culling during outbreaks. Using a spatially-explicit, stochastic, state-transition simulation algorithm originally developed by Keeling et al. 2001 to model FMD spread in the United Kingdom, we simulated this reduced-farm-density, or "target density" strategy. We modeled FMD disease spread in four counties in the UK (Aberdeenshire, Cumbria, Devon, and North Yorkshire) that have different farm demographies. We ran 740,000 simulations in a full-factorial analysis of epidemic impact measurements (i.e. culled animals, culled farms, epidemic length) and cull strategy parameters (i.e. target farm density, daily farm cull capacity, cull radius). We found that all of the cull strategy parameters were drivers of epidemic impact. We found that outbreaks in Cumbria had higher epidemic impacts and were more likely to take off compared with other counties with more outbreaks being likely to take off in Cumbria. Most importantly, in all counties, our proposed target density strategy was more effective at combatting FMD compared with traditional 'total ring depopulation' when considering average culled animals and culled farms. The differences in epidemic impact between the counties are likely driven by farm demography, especially differences in cattle and farm density. This target density strategy can be applied to many different systems, including other livestock and agricultural systems, to reduce host density as opposed to over-culling hosts.

opencc-zeroAug 2021View details →

dryad40/100

Statistical analysis code for output from a model used to simulate foot-and-mouth disease dynamics in the United Kingdom

Open the record for dataset details and reuse information.

publicAug 2021View details →

zenodo36/100

Putative parapoxvirus-associated foot disease in the endangered huemul deer (Hippocamelus bisulcus) in Bernardo O'Higgins National Park, Chile

The huemul (Hippocamelus bisulcus) is an endangered cervid endemic to southern Argentina and Chile. Here we report foot lesions in 24 huemul from Bernardo O’Higgins National Park, Chile, between 2005 and 2010. Affected deer displayed variably severe clinical signs, including lameness and soft tissue swelling of the limbs proximal to the hoof or in the interdigital space, ulceration of the swollen tissues, and some developed severe proliferative tissue changes that caused various types of abnormal wear, entrapment, and/or displacement of the hooves and/or dewclaws. Animals showed signs of intense pain and reduced mobility followed by loss of body condition and recumbency, which often preceded death. The disease affected both genders and all age categories. Morbidity and mortality reached 80% and 40%, respectively. Diagnostics were restricted to a limited number of cases from which samples were available. Histology revealed severe papillomatous epidermal hyperplasia and superficial dermatitis. Electron microscopy identified viral particles consistent with viruses in the Chordopoxvirinae subfamily. The presence of parapoxvirus DNA was confirmed by a pan-poxvirus PCR assay, showing high identity (98%) with bovine papular stomatitis virus and pseudocowpoxvirus. This is the first report of foot disease in huemul deer in Chile, putatively attributed to poxvirus. Given the high morbidity and mortality observed, this virus might pose a considerable conservation threat to huemul deer in Chilean Patagonia. Moreover, this report highlights a need for improved monitoring of huemul populations and synergistic, rapid response efforts to adequately address disease events that threaten the species.

opencc-by-4.0Mar 2019View details →

ClinicalTrials.gov36/100

Improving Mobility in Peripheral Artery Disease Using an Ankle Foot Orthosis

ClinicalTrials.gov study NCT02902211. IPD Sharing: YES. Countries: 1. Publications: 1.

controlledIPD-YESFeb 2026View details →

ClinicalTrials.gov36/100

Ankle-foot Orthoses for Peripheral Artery Disease

ClinicalTrials.gov study NCT02280200. IPD Sharing: UNDECIDED. Countries: 1. Publications: 1.

restrictedIPD-UNDECIDEDFeb 2026View details →

ClinicalTrials.gov36/100

Efficacy and Safety of Intramuscular PDA-002 in Subjects Who Have Diabetic Foot Ulcer With and Without Peripheral Arterial Disease

ClinicalTrials.gov study NCT02264288. IPD Sharing: Not stated. Countries: 1. Publications: 0.

restrictedIPD-UNDECIDEDFeb 2026View details →

dryad36/100

Data from: An antigen panel to assess the regional relevance of foot and mouth disease vaccines

Open the record for dataset details and reuse information.

publicMay 2025View details →

dryad32/100

Data from: The history of foot-and-mouth disease virus serotype C: the first known extinct serotype?

Foot-and-mouth disease (FMD) is a highly contagious animal disease caused by an RNA virus subdivided into seven serotypes that are unevenly distributed in Asia, Africa and South America. Despite the challenges of controlling FMD, since 1996 there have been only two outbreaks attributed to serotype C, in Brazil and in Kenya, in 2004. This review describes the historical distribution and origins of serotype C and its disappearance. The serotype was first described in Europe in the 1920s, where it mainly affected pigs and cattle but as a less common cause of outbreaks than serotypes O and A. No serotype C outbreaks have been reported in Europe since vaccination stopped in 1990. FMD virus is presumed to have been introduced into South America from Europe in the 19th century, although whether serotype C evolved there or in Europe is not known. As in Europe, this serotype was less widely distributed and caused fewer outbreaks than serotypes O and A. Since 1994, serotype C had not been reported from South America until four small outbreaks were detected in the Amazon region in 2004. Elsewhere, serotype C was introduced to Asia, in the 1950s to the 1970s, persisting and evolving for several decades in the Indian subcontinent and for eighteen years in the Philippines. Serotype C virus also circulated in East Africa between 1957 and 2004. Many serotype C viruses from European and Kenyan outbreaks were closely related to vaccine strains, including the most recently recovered Kenyan isolate from 2004. International surveillance has not confirmed any serotype C cases, worldwide, for over 15 years, despite more than 2000 clinical submissions per year to reference laboratories. Serology provides limited evidence for absence of this serotype, as unequivocal interpretation is hampered by incomplete intra-serotype specificity of immunoassays and the continued use of this serotype in vaccines. It is recommended to continue strengthening surveillance in regions of FMD endemicity, to stop vaccination against serotype C and to reduce working with the virus in laboratories, since inadvertent escape of virus during such activities is now the biggest risk for its reappearance in the field.

opencc-zeroJan 2021View details →

dryad32/100

Data from: Economic costs and health-related quality of life for hand, foot and mouth disease (HFMD) patients in China

Background: Hand, foot and mouth disease (HFMD) is a common illness in China that mainly affects infants and children. The objective of this study is to assess the economic cost and health-related quality of life associated with HFMD in China. Method: A telephone survey of caregivers were conducted in 31 provinces across China. Caregivers of laboratory-confirmed HFMD patients who were registered in the national HFMD enhanced surveillance database during 2012-2013 were invited to participate in the survey. Total costs included direct medical costs (outpatient care, inpatient care and self-medication), direct non-medical costs (transportation, nutrition, accommodation and nursery), and indirect costs for lost income associated with caregiving. Health utility weights elicited using EuroQol EQ-5D-3L and EQ-Visual Analogue Scale (VAS) were used to calculate associated loss in quality adjusted life years (QALYs). Results: The subjects comprised 1136 mild outpatients, 1124 mild inpatients, 1170 severe cases and 61 fatal cases. The mean total costs for mild outpatients, mild inpatients, severe cases and fatal cases were $201 (95%CI $187, $215), $1072 (95%CI $999, $1144), $3051 (95%CI $2905, $3197) and $2819 (95%CI $2068, $3571) respectively. The mean QALY losses per HFMD episode for mild outpatients, mild inpatients and severe cases were 3.6 (95%CI 3.4, 3,9), 6.9 (95%CI 6.4, 7.4) and 13.7 (95%CI 12.9, 14.5) per 1000 persons. Cases who were diagnosed with EV-A71 infection and had longer duration of illness were associated with higher total cost and QALY loss. Conclusion: HFMD poses a high economic and health burden in China. Our results provide economic and health utility data for cost-effectiveness analysis for HFMD vaccination in China.

opencc-zeroDec 2016View details →

dryad32/100

Data from: Phylogeographic and cross-species transmission dynamics of SAT1 and SAT2 Foot-and-Mouth Disease Virus in Eastern Africa

Understanding the dynamics of foot-and-mouth disease virus (FMDV), an endemic and economically constraining disease, is critical in designing control programs in Africa. This study investigates the evolutionary epidemiology of SAT1 and SAT2 FMDV in Eastern Africa, as well as between cattle and wild African buffalo. Bayesian phylodynamic models were used to analyze SAT1 and SAT2 VP1 gene segments collected between 1975 and 2016, focusing on the SAT1 and SAT2 viruses currently circulating in Eastern Africa. The root state posterior probabilities inferred from our analyses suggest Zimbabwe as the ancestral location for SAT1 currently circulating in Eastern Africa (P=0.67). For the SAT2 clade, Kenya is inferred to be the ancestral location for introduction of the virus into other countries in Eastern Africa (P=0.72). Salient (Bayes Factor >10) viral dispersal routes were inferred from Tanzania to Kenya, and from Kenya to Uganda for SAT1 and SAT2, respectively. Results suggest that cattle are the source of the SAT1 and SAT2 clades currently circulating in Eastern Africa. In addition, our results suggest that the majority of SAT1 and SAT2 in livestock come from other livestock rather than wildlife, with limited evidence that buffalo serve as reservoirs for cattle. Insights from the present study highlight the role of cattle movements and anthropogenic activities in shaping the evolutionary history of SAT1 and SAT2 in Eastern Africa. While the results may be affected by inherent limitations of imperfect surveillance, our analysis elucidates the dynamics between host species in this region, which is key to guiding disease intervention activities

opencc-zeroDec 2018View details →

ClinicalTrials.gov32/100

Effectiveness and Safety of Chinese Medicine to Treat Hand, Foot, and Mouth Disease

ClinicalTrials.gov study NCT01554930. IPD Sharing: Not stated. Countries: 1. Publications: 5.

restrictedIPD-UNDECIDEDFeb 2026View details →

ClinicalTrials.gov32/100

A Multi-Center Clinical Trial To Evaluate Chinese Herbal Medicines in the Treatment of Severe Hand-foot-mouth Disease

ClinicalTrials.gov study NCT01145664. IPD Sharing: Not stated. Countries: 1. Publications: 1.

restrictedIPD-UNDECIDEDFeb 2026View details →

ClinicalTrials.gov32/100

Hand, Foot, and Mouth Disease: Could EPs®7630 be a Treatment Option

ClinicalTrials.gov study NCT06353477. IPD Sharing: YES. Countries: 1. Publications: 2.

controlledIPD-YESFeb 2026View details →

ClinicalTrials.gov32/100

Magnesium Sulphate for Severe Hand, Foot and Mouth Disease in Vietnam

ClinicalTrials.gov study NCT01940250. IPD Sharing: Not stated. Countries: 1. Publications: 2.

restrictedIPD-UNDECIDEDFeb 2026View details →

ClinicalTrials.gov32/100

Foot Mechanical Stimulation for Treatment of Gait and Gait Related Disorders in Parkinson's Disease and Progressive Supranuclear Palsy.

ClinicalTrials.gov study NCT01815281. IPD Sharing: Not stated. Countries: 1. Publications: 1.

restrictedIPD-UNDECIDEDFeb 2026View details →

ClinicalTrials.gov32/100

Plantar Pressure Analysis and Foot Biomechanics in Lipedema and Chronic Venous Disease

ClinicalTrials.gov study NCT06238791. IPD Sharing: NO. Countries: 1. Publications: 2.

closedIPD-NOFeb 2026View details →

ClinicalTrials.gov32/100

The Effects of Custom-made Insoles on Foot Pressure Redistribution and Spatio - Temporal Gait Parameters in Sever Disease

ClinicalTrials.gov study NCT03787316. IPD Sharing: Not stated. Countries: 1. Publications: 1.

restrictedIPD-UNDECIDEDFeb 2026View details →

ClinicalTrials.gov32/100

A Serosurvey Study of Hand, Foot, and Mouth Disease in Indonesia

ClinicalTrials.gov study NCT05637229. IPD Sharing: Not stated. Countries: 1. Publications: 1.

restrictedIPD-UNDECIDEDFeb 2026View details →

dryad32/100

Data from: The impact of resources for clinical surveillance on the control of a hypothetical foot-and-mouth disease epidemic in Denmark

Open the record for dataset details and reuse information.

publicJun 2015View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas

neuroscienceopenDocumentation, web resources, and API references are available online.

Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage

behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.

Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb

electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.

Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl

behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.

Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro

neuroscienceopenPublished datasets are available on demand over the internet.

Last verified 2026-04-29Open record