Find research datasets worth reusing

opencc-by-4.0Jun 2024View details →

Data described in the article "Unraveling the diversity of hyphal explorative traits among Rhizophagus irregularis genotypes"

The dataset includes supplementary Figures, tables and the results of two experiments published in the study titled "Unraveling the diversity of hyphal explorative traits among Rhizophagus irregularis genotypes", available here: https://doi.org/10.1007/s00572-024-01154-8 The study compares seven homokaryotic isolates (genotypes) of Rhizophagus irregularis, aiming to characterize the range of intraspecific variability with respect to hyphal exploration of organic nitrogen (N) resources, and N supply to plants. Two experiments (one in vitro and one in open pots) were conducted, and 15N-chitin as the isotopically labeled organic N source was used. Experiment 1 (in vitro), mycelium of all arbuscular mycorrhizal (AM) fungal genotypes transferred a higher amount of 15N to the plants than the passive transfer of 15N measured in the non-mycorrhizal (NM) controls. Noticeably, certain genotypes (e.g., LPA9) showed higher extraradical mycelium biomass production but not necessarily greater 15N acquisition than the others.  Experiment 2 (in pots) highlighted that some of the AM fungal genotypes (e.g., MA2, STSI) exhibited higher rates of targeted hyphal exploration of chitin-enriched zones, indicative of distinct N exploration patterns from the other genotypes. Dataset contain photos and other recorded parameters during the experiment 1 and experiment 2.

Figure 4 in PCR-RFLP Based genetic diversity of Plasmodium vivax genotypes in district Mardan, Pakistan

Figure 4. Prevalence of six different sub-allele types of Pvmsp-3β (A1-A3, B1-B2 and C1) based on PCR-RFLP.

Figure 2 in PCR-RFLP Based genetic diversity of Plasmodium vivax genotypes in district Mardan, Pakistan

Figure 2. Prevalence of nine different sub-allele types of Pvmsp- 3α(A1-A4), (B1-B3), C1 and D are the nine different alleles from PCR-RFLP.

opencc-by-4.0Apr 2024View details →

Fig. 1 in Genotypic diversity and epidemiology of Trichomonas gallinae in Columbidae: Insights from a comprehensive analysis

Fig. 1. Systematic phylogenetic tree based on Trichomonas.sp ITS1/5.8S/ITS2 gene typing. The length of ITS1/5.8S/ITS2 was 223bp. This tree was generated using MEGA-X software and calculated using the Tamamura 3-parameter (T92) + G model and the neighbor-joining method with 2,000 bootstrap replicates. Bootstrap values <70% were not shown.

opencc-by-4.0Apr 2024View details →

Fig. 2 in Genotypic diversity and epidemiology of Trichomonas gallinae in Columbidae: Insights from a comprehensive analysis

Fig. 2. Time-driven diagram of the epidemic characteristics of T. gallinae. The red font in the genotype box indicated T. gallinae genotypes with high prevalence rates. The other red font denoted highly susceptible animals, whereas the thick blue arrow indicated the factors influencing the differences in T. gallinae positivity rates. The content inside the orange box highlighted the main factors affecting the differences in T. gallinae positivity rates. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Multi-location trials and population-based genotyping reveal high diversity and adaptation to breeding environments in a large collection of red clover

This dataset accompanies the article with the same title made available on bioRxiv <a href="https://doi.org/10.1101/2022.12.19.520744">https://doi.org/10.1101/2022.12.19.520744</a>

opencc-zeroApr 2023View details →

dryad40/100

Genotype and genetic diversity data for: Contrasts in riverscape patterns of intraspecific genetic variation in a diverse Neotropical fish community of high conservation value

Spatial patterns in genetic variation compared across species provide information about the predictability of genetic diversity of natural populations and areas requiring conservation measures. Due to their remarkable fish diversity, rivers in Neotropical regions are ideal systems to confront theory with observations and would benefit greatly from such approaches given their increasing vulnerability to anthropogenic pressures. We used SNP data from 18 fish species with contrasting life-history traits, co-sampled across 12 sites in the Maroni – a major river system from the Guiana Shield – to compare patterns of intraspecific genetic variation and identify their underlying drivers. Analyses of covariance revealed a decrease in genetic diversity as distance from the river outlet increased for 5 of the 18 species, illustrating a pattern commonly observed in riverscapes for species with low-to-medium dispersal abilities. However, mean within-site genetic diversity was lowest in the two easternmost tributaries of the Upper Maroni and around an urbanized location downstream, indicating the need to address the potential influence of local pressures in these areas, such as goldmining or fishing. Finally, the relative influence of isolation by stream distance, isolation by discontinuous river flow and isolation by spatial heterogeneity in effective size on pairwise genetic differentiation varied across species. Species with similar dispersal and reproductive guilds did not necessarily display shared patterns of population structure. Increasing the knowledge of specific life history traits and ecological requirements of fish species in these remote areas should help further understand factors that influence their current patterns of genetic variation.

opencc-by-4.0Sep 2022View details →

Data for: Single-gene resolution of diversity-driven overyielding in plant genotype mixtures

In plant communities, diversity often increases productivity and functioning, but the specific underlying drivers are difficult to identify. Most ecological theories attribute positive diversity effects to complementary niches occupied by different species or genotypes. However, the specific nature of niche complementarity often remains unclear, including how it is expressed in terms of trait differences between plants. Here, we use a gene-centred approach to study positive diversity effects in mixtures of natural Arabidopsis thaliana genotypes. Using two orthogonal genetic mapping approaches, we find that between-plant allelic differences at the AtSUC8 locus are strongly associated with mixture overyielding. AtSUC8 encodes a proton-sucrose symporter and is expressed in root tissues. Genetic variation in AtSUC8 affects the biochemical activities of protein variants and natural variation at this locus is associated with different sensitivities of root growth to changes in substrate pH. We thus speculate that - in the particular case studied here - evolutionary divergence along an edaphic gradient resulted in the niche complementarity between genotypes that now drives overyielding in mixtures. Identifying such genes important for ecosystem functioning may ultimately allow linking ecological processes to evolutionary drivers, help identify traits underlying positive diversity effects, and facilitate the development of high-performing crop variety mixtures.

dryad40/100

Genotype and genetic diversity data for: Contrasts in riverscape patterns of intraspecific genetic variation in a diverse Neotropical fish community of high conservation value

Open the record for dataset details and reuse information.

publicApr 2023View details →

opencc-zeroDec 2023View details →

Data for: A diverse parasite pool can improve effectiveness of biological control constrained by genotype-by-genotype interactions

The outcomes of biological control programs can be highly variable, with natural enemies often failing to establish or spread in pest populations. This variability has posed a major obstacle in use of the bacterial parasite Pasteuria penetrans for biological control of Meloidogyne species, economically devastating plant-parasitic nematodes for which there are limited management options. A leading hypothesis for this variability in control is that infection is successful only for specific combinations of bacterial and nematode genotypes. Under this hypothesis, failure of biological control results from the use of P. penetrans genotypes that cannot infect local Meloidogyne genotypes. We tested this hypothesis using isofemale lines of M. arenaria derived from a single field population and multiple sources of P. penetrans from the same and nearby fields. In strong support of the hypothesis, susceptibility to infection depended on the specific combination of host line and parasite source, with lines of M. arenaria varying substantially in which P. penetrans source could infect them. In light of this result, we tested whether using a diverse pool of P. penetrans could increase infection and thereby control. We found that increasing the diversity of the P. penetrans inoculum from one to eight sources more than doubled the fraction of M. arenaria individuals susceptible to infection and reduced variation in susceptibility across host lines. Together, our results highlight genotype-by-genotype specificity as an important cause of variation in biological control and call for the maintenance of genetic diversity in natural enemy populations.

opencc-zeroOct 2023View details →

First insights into population structure and genetic diversity versus host specificity in trypanorhynch tapeworms using multiplexed shotgun genotyping

Theory predicts relaxed host specificity and high host vagility should contribute to reduced genetic structure in parasites while strict host specificity and low host vagility should increase genetic structure. Though these predictions are intuitive, they have never been explicitly tested in a population genomic framework. Trypanorhynch tapeworms, which parasitize sharks and rays (elasmobranchs) as definitive hosts, are the only order of elasmobranch tapeworms that exhibit considerable variability in their definitive host specificity. This allows for unique combinations of host use and geographic range, making trypanorhynchs ideal candidates for studying how these traits influence population-level structure and genetic diversity. Multiplexed shotgun genotyping (MSG) datasets were generated to characterize component population structure and infrapopulation diversity for a representative of each trypanorhynch suborder: the ray-hosted Rhinoptericola megacantha (Trypanobatoida) and the shark-hosted Callitetrarhynchus gracilis (Trypanoselachoida). Adults of R. megacantha are more host-specific and less broadly distributed than adults of C. gracilis, allowing correlation between these factors and genetic structure. Replicate tapeworm specimens were sequenced from the same host individual, from multiple conspecific hosts within and across geographic regions, and from multiple definitive host species. For R. megacantha, population structure coincided with geography rather than host species. For C. gracilis, limited population structure was found, suggesting a potential link between degree of host specificity and structure. Conspecific trypanorhynchs from the same host individual were found to be as, or more, genetically divergent from one another as from conspecifics from different host individuals. For both species, high levels of homozygosity and positive FIS values were documented.

zenodo36/100

E. coli-ΦX174 genotype to phenotype map reveals flexibility and diversity in LPS structures

Here are the raw sequencing data of all E. coli C and ΦX174 strains obtained during this study. A short description of each file's content can be found below.   Bacteria <ul> <li>"E.coliC_res.zip": Whole genome sequencing results of E. coli C WT and ΦX174-resistant strains (generated by fluctuation experiments). All E. coli C samples were prepared for whole-genome sequencing from one millilitre of stationary-phase cultures. Genomic DNA was extracted using the Wizard® Genomic DNA purification Kit (Promega, Germany). Bacterial samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany) using an Illumina Nextera DNA Flex Library Prep Kit to produce 150 bp paired-end reads.</li> </ul>   <ul> <li>"E.coliC_res_excluded.zip": Whole genome sequencing results of the four ΦX174-resistant E. coli C strains (generated by fluctuation experiments) that have been excluded from the analyses: E. coli C R1, R3, R15, and R19. We found that both E. coli C R3 and R15 were not isogenic. While whole-genome sequencing from their respective glycerol stocks showed only a single mutation in galE, whole-genome sequencing carried on colony re-streaks showed that additional mutations were systematically associated with the single mutation in galE (see file "E.coliC_res_excluded_10_clones). E. coli C R1 displayed an unstable resistant phenotype. Finally, E. coli C R19 was partially resistant to ΦX174 WT. It carries a single mutation in the yajC gene, which encodes for a periplasmic protein. No apparent link to the LPS biosynthesis or assembly has been discovered yet, but yajC might play a role in phage DNA injection into the bacterium’s cytoplasmic membrane.</li> </ul>   <ul> <li>"E.coliC_res_excluded_10_clones.zip": Whole genome sequencing results of 10 randomly chosen isolates of E. coli C R1, R3, and R15.</li> </ul>   <ul> <li>"EcoliC.gb": E. coli C WT strain used as reference.</li> </ul>   Bacteriophages   <ul> <li>“PhiX174_PCR_399r_400f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul>   PhiX174_399_r: CTTGACTCATGATTTCTTACC PhiX174_400_f: TTACTGAACAATCCGTACGTTTC   DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads.   <ul> <li>“PhiX174_PCR_2361r_2362f.zip”: ΦX174 samples were prepared for whole genome re-sequencing from 1 mL of phage lysate. Genomic DNA was extracted using the QIAprep Spin Miniprep Kit (QIAGEN), then amplified by performing 20 cycles of PCR using Q5® High-Fidelity 2X Master Mix (NEB). The sets of primers used for the amplification of ΦX174 whole genome are:</li> </ul>   PhiX174_2361_r: TCGCTTGGTCAACCCCTCAG PhiX174_2362_f: AGCGCGGTAGGTTTTCTGCT   DNA samples were tested for quality, pooled, and sequenced by the Max-Planck Institute for Evolutionary Biology (Plön, Germany). Sequencing was performed using an Illumina MiSeq DNA Flex Library Prep Kit to produce 150 bp paired-end reads. <ul> <li>“PhiX174_excluded.zip”: Since we removed R19 from the final analysis, we also removed its corresponding evolved phage obtained during the first evolution experiment (ΦX174 R19 T1). We also removed the phage infecting R5 (ΦX174 R5 T2) because it was not isogenic (confirmed by Sanger Sequencing).</li> </ul> <ul> <li>“PhiX174_Sequencing_Sanger.zip”: Both F and H genes were amplified by performing 35 cycles of PCR using Phusion® High-Fidelity PCR Master Mix with HF Buffer. The sequencing primers are listed in the Information_Sanger_Samples_ID.xlsx file.</li> </ul>   <ul> <li>“PhiX174_ref.gb”: PhiX174 WT strain used as reference.</li> </ul>   We also include the raw data and pictures from our spotting tests and plaque assays used to complete the final matrix of infection. <ul> <li>Spotting_tests_reanalyzed.xlsx”: Raw data from the pictures (see Photos_matrices.zip) used to generate the Hierarchical agglomerative clustering analysis of the host ranges of evolved phage and Infection matrix of evolved ΦX174 phages on the 31 resistant E. coli C strains.</li> </ul> The Photos_matrices.zip folder contains   <ul> <li>“SSA_matrix_Bact_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted phages on bacterial lawns.</li> </ul>   <ul> <li>“SSA_matrix_Phi_Lawn”: pictures of all evolution experiments obtained from the spotting test method where we spotted bacteria on phage lawns.</li> </ul>   <ul> <li>“Mismatches”: We performed plaque assays when combinations of phages and bacteria showed discrepancies between the two spotting test methods</li> </ul>   <ul> <li>“Plaque_assays_R12_R14”: pictures of plaque assays where we tested the sensitivity of E. coli C R12 and R14 toward a subset of evolved phages</li> </ul>   <ul> <li>“Plaque_assays_of_PhiX174R22T1c1/R28T1c1_vs_WT”: pictures of plaque assays where we tested the sensitivity of E. coli C WT toward phages infecting R22 and R28.</li> </ul>   <ul> <li>“displayImage.R”. Script made to look for the desired combination of phage and bacterium.</li> </ul>   Finally, we include the raw OD measurments:   <ul> <li>“All_EcoliC_growth_raw_data.xlsx”: raw OD measurements of each E. coli C resistant strains used in this study.</li> </ul>

opencc-by-4.0Sep 2022View details →

opencc-zeroApr 2024View details →

Variation and plasticity in life-history traits and fitness of wild Arabidopsis thaliana populations are not related to their genotypic and ecological diversity

Despite its implications for population dynamics and evolution, the relationship between genetic and phenotypic variation in wild populations remains unclear. Here, we estimated variation and plasticity in life-history traits and fitness of the annual plant Arabidopsis thaliana in two common garden experiments that differed in environmental conditions. We used up to 306 maternal inbred lines from six Iberian populations characterized by low and high genotypic (based on whole-genome sequences) and ecological (vegetation type) diversity. Low and high genotypic and ecological diversity was found in edge and core Iberian environments, respectively. Given that selection is expected to be stronger in edge environments and that ecological diversity may enhance both phenotypic variation and plasticity, we expected genotypic diversity to be positively associated with phenotypic variation and plasticity. However, maternal lines, irrespective of the genotypic and ecological diversity of their population of origin, exhibited a substantial amount of phenotypic variation and plasticity for all traits. Furthermore, all populations harbored maternal lines with canalization (robustness) or sensitivity in response to harsher environmental conditions in one of the two experiments. Overall, we conclude that the environmental attributes of each population probably determine their genotypic diversity, but all populations maintain substantial phenotypic variation and plasticity for all traits, which represents an asset to endure in changing environments.

opencc-zeroApr 2024View details →

Ecological divergence despite common mating sites: Genotypes and symbiotypes shed light on cryptic diversity in the black bean aphid species complex

Different host plants represent ecologically dissimilar environments for phytophagous insects. The resulting divergent selection can promote the evolution of specialized host races, provided that gene flow is reduced between populations feeding on different plants. In black bean aphids belonging to the Aphis fabae complex, several morphologically cryptic taxa have been described based on their distinct host plant preferences. However, host choice and mate choice are largely decoupled in these insects: they are host-alternating and migrate between specific summer host plants and shared winter hosts, with mating occurring on the shared hosts. This provides a yearly opportunity for gene flow among aphids using different summer hosts, and raises the question if and to what extent the ecologically defined taxa are reproductively isolated. Here, we analyzed a geographically and temporally structured dataset of microsatellite genotypes from A. fabae that were mostly collected from their main winter host Euonymus europaeus, and additionally from another winter host and fourteen summer hosts. The data reveals multiple, strongly differentiated genetic clusters, which differ in their association with different summer and winter hosts. The clusters also differ in the frequency of infection with two heritable, facultative endosymbionts, separately hinting at reproductive isolation and divergent ecological selection. Furthermore, we found evidence for occasional hybridization among genetic clusters, with putative hybrids collected more frequently in spring than in autumn. This suggests that similar to host races in other phytophagous insects, both prezygotic and postzygotic barriers including selection against hybrids maintain genetic differentiation among A. fabae taxa, despite a common mating habitat.

opencc-zeroMay 2024View details →

Data from: Analysis of genotyping data reveals the unique genetic diversity represented by the breeds of sheep native to the United Kingdom

Background: Sheep breeds native to the United Kingdom are noted for high breed variability and exhibit a striking diversity of different traits in phenotypes and genetic diversity. Some of these traits are highly sustainable, such as seasonal wool shedding in the Wiltshire Horn, are likely to become more important as pressures on sheep production increase in coming decades. Despite their clear importance to the future of sheep farming, the genetic diversity of native UK sheep breeds is poorly characterised. This increases the risk of losing the ability to select for breed-specific traits from native breeds that might be important to the UK sheep sector in the future. Here, we use 50K genotyping to perform preliminary analysis of breed relationships and genetic diversity within native UK sheep breeds, as a first step towards a comprehensive characterisation. This study generates novel data for thirteen native UK breeds, including 6 on the UK Breeds at Risk (BAR) list, and utilises existing data from the publicly available Sheep HapMap dataset to investigate population structure, heterozygosity and admixture. Results: In this study the commercial breeds exhibited high levels of admixture, weaker population structure and had higher heterozygosity compared to the other native breeds, which generally tend to be more distinct, less admixed, and have lower genetic diversity and higher kinship coefficients. Some breeds including the Wiltshire Horn, Lincoln Longwool and Ryeland showed very little admixture at all, indicating a high level of breed integrity but potentially low genetic diversity. Population structure and admixture were strongly influenced by sample size and sample provenance – highlighting the need for equal sample sizes, sufficient numbers of individuals per breed, and sampling across multiple flocks. The genetic profiles both within and between breeds were highly complex for UK sheep, reflecting the complexity in the demographic history of these breeds. Conclusion: Our results highlight the utility of genotyping data for investigating breed diversity and genetic structure. They also suggest that routine generation of genotyping data would be very useful in informing conservation strategies for rare and declining breeds with small populations sizes. We conclude that generating genetic resources for the sheep breeds that are native to the UK will help preserve the considerable genetic diversity represented by these breeds, and safe guard this diversity as a valuable resource for the UK sheep sector to utilise in the face of future challenges.

zenodo36/100

Figure 1 in PCR-RFLP Based genetic diversity of Plasmodium vivax genotypes in district Mardan, Pakistan

Figure 1. Prevalence of four different alleles of Pvmsp-3α (A, B, C and D) from PCR-RFLP