Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
43
datasets available to search
ShareScore release 0.7.1
Dataset results
43 results for “sedimentary DNA”
Data for: Sedimentary ancient DNA and pollen reveal the composition of plant organic matter in Late Quaternary permafrost sediments of the Buor Khaya Peninsula (north-eastern Siberia)
<p>Organic matter deposited in ancient, ice-rich permafrost sediments is vulnerable to climate change and may contribute to the future release of greenhouse gases; it is thus important to get a better characterization of the plant organic matter within such sediments. From a Late Quaternary permafrost sediment core from the Buor Khaya Peninsula, we analysed plant-derived sedimentary ancient DNA (sedaDNA) to identify the taxonomic composition of plant organic matter, and undertook palynological analysis to assess the environmental conditions during deposition. Using sedaDNA, we identified 154 taxa and from pollen and non-pollen palynomorphs we identified 83 taxa. In the deposits dated between 54 and 51 kyr BP, sedaDNA records a diverse low-centred polygon plant community including recurring aquatic pond vegetation while from the pollen record we infer terrestrial open-land vegetation with relatively dry environmental conditions at a regional scale. A fluctuating dominance of either terrestrial or swamp and aquatic taxa in both proxies allowed the local hydrological development of the polygon to be traced. In deposits dated between 11.4 and 9.7 kyr BP (13.4–11.1 cal kyr BP), sedaDNA shows a taxonomic turnover to moist shrub tundra and a lower taxonomic richness compared to the older samples. Pollen also records a shrub tundra community, mostly seen as changes in relative proportions of the most dominant taxa, while a decrease in taxonomic richness was less pronounced compared to sedaDNA. Our results show the advantages of using sedaDNA in combination with palynological analyses when macrofossils are rarely preserved. The high resolution of the sedaDNA record provides a detailed picture of the taxonomic composition of plant-derived organic matter throughout the core, and palynological analyses prove valuable by allowing for inferences of regional environmental conditions.</p>
Permafrost-thaw lake development in Central Yakutia: sedimentary ancient DNA and element analyses from a Holocene sediment record
<p>In Central Yakutia (Siberia) livelihoods of local communities depend on alaas (thermokarst depression) landscapes and the lakes within. Development and dynamics of these alaas lakes are closely connected to climate change, permafrost thawing, catchment conditions, and land use. To reconstruct lake development throughout the Holocene we analyze sedimentary ancient DNA (sedaDNA) and biogeochemistry from a sediment core from Lake Satagay, spanning the last c. 10,800 calibrated years before present (cal yrs BP). SedaDNA of diatoms and macrophytes and microfossil diatom analysis reveal lake formation earlier than 10,700 cal yrs BP. The sedaDNA approach detected 42 amplicon sequence variants (ASVs) of diatom taxa, one ASV of Eustigmatophyceae (Nannochloropsis), and 12 ASVs of macrophytes. We relate diatom and macrophyte community changes to climate-driven shifts in water level and mineral and organic input, which result in variable water conductivity, in-lake productivity, and sediment deposition. We detect a higher lake level and water conductivity in the Early Holocene (c. 10,700–7000 cal yrs BP) compared to other periods, supported by the dominance of Stephanodiscus sp. and Stuckenia pectinata. Further climate warming towards the Mid-Holocene (7000–4700 cal yrs BP) led to a shallowing of Lake Satagay, an increase of the submerged macrophyte Ceratophyllum, and a decline of planktonic diatoms. In the Late Holocene (c. 4700 cal yrs BP–present) stable shallow water conditions are confirmed by small fragilarioid and staurosiroid diatoms dominating the lake. Lake Satagay has not yet reached the final stage of alaas development, but satellite imagery shows an intensification of anthropogenic land use, which in combination with future warming will likely result in a rapid desiccation of the lake.</p>
Data from: evaluating the use of lake sedimentary DNA in palaeolimnology: a comparison with long-term microscopy-based monitoring of the phytoplankton community
<p>Palaeolimnological records provide valuable information about how phytoplankton respond to long-term drivers of environmental change. Traditional palaeolimnological tools such as microfossils and pigments are restricted to taxa that leave sub-fossil remains, and a method that can be applied to the wider community is required. Sedimentary DNA (sedDNA), extracted from lake sediment cores, shows promise in palaeolimnology, but validation against data from long-term monitoring of lake water is necessary to enable its development as a reliable record of past phytoplankton communities. To address this need, 18S rRNA gene amplicon sequencing was carried out on lake sediments from a core collected from Esthwaite Water (English Lake District) spanning ~105 years. This sedDNA record was compared with concurrent long-term microscopy-based monitoring of phytoplankton in the surface water. Broadly comparable trends were observed between the datasets, with respect to the diversity and relative abundance and occurrence of chlorophytes, dinoflagellates, ochrophytes and bacillariophytes. Up to 20% of genera were successfully captured using both methods, and sedDNA revealed a previously undetected community of phytoplankton. These results suggest that sedDNA can be used as an effective record of past phytoplankton communities, at least over timescales of less than 100 years. However, a substantial proportion of genera identified by microscopy were not detected using sedDNA, highlighting the current limitations of the technique that require further development such as reference database coverage. The taphonomic processes which may affect its reliability, such as the extent and rate of deposition and DNA degradation, also require further research.</p>
Data for: Sedimentary ancient DNA and pollen reveal the composition of plant organic matter in Late Quaternary permafrost sediments of the Buor Khaya Peninsula (north-eastern Siberia)
Open the record for dataset details and reuse information.
Data from: evaluating the use of lake sedimentary DNA in palaeolimnology: a comparison with long-term microscopy-based monitoring of the phytoplankton community
Open the record for dataset details and reuse information.
Permafrost-thaw lake development in Central Yakutia: sedimentary ancient DNA and element analyses from a Holocene sediment record
Open the record for dataset details and reuse information.
Data from: The history of tree and shrub taxa on Bol'shoy Lyakhovsky Island (New Siberian Archipelago) since the last interglacial uncovered by sedimentary ancient DNA and pollen data
<p>Ecosystem boundaries, such as the Arctic-Boreal treeline, are strongly coupled with climate and were spatially highly dynamic during past glacial-interglacial cycles. Only a few studies cover vegetation changes since the last interglacial, as most of the former landscapes are inundated and difficult to access. Using pollen analysis and sedimentary ancient DNA (<span class="html-italic">s</span>edaDNA) metabarcoding, we reveal vegetation changes on Bol'shoy Lyakhovsky Island since the last interglacial from permafrost sediments. Last interglacial samples depict high levels of floral diversity with the presence of trees (<em><span class="html-italic">Larix</span></em>,<span class="html-italic"> <em>Picea</em></span>,<span class="html-italic"> <em>Populus</em></span>) and shrubs (<em><span class="html-italic">Alnus</span></em>, <em><span class="html-italic">Betula</span></em>, <em><span class="html-italic">Ribes</span></em>, <span class="html-italic"><em>Cornus</em>, </span>Saliceae) on the currently treeless island. After the Last Glacial Maximum, <em><span class="html-italic">Larix</span> </em>re-colonised the island but disappeared along with most shrub taxa. This was probably caused by Holocene sea-level rise, which led to increased oceanic conditions on the island. Additionally, we applied two newly developed larch-specific chloroplast markers to evaluate their potential for tracking past population dynamics from environmental samples. The novel markers were successfully re-sequenced and exhibited two variants of each marker in last interglacial samples. SedaDNA can track vegetation changes as well as genetic changes across geographic space through time and can improve our understanding of past processes that shape modern patterns.</p>
Phylogenetic diversity and environment form assembly rules for Arctic diatom genera – a study on recent and ancient sedimentary DNA
<p><span><b>Aim</b></span></p> <p><span>This study investigates taxonomic and phylogenetic diversity in diatom genera to evaluate assembly rules for eukaryotic microbes across the Siberian treeline. We first analysed how phylogenetic distance relates to taxonomic richness and turnover. Second, we used relatedness indices to evaluate if environmental filtering or competition influences the assemblies in space and through time. Third, we used distance-based ordination to test which environmental variables shape diatom turnover.</span></p> <p><span><b>Location</b></span></p> <p><span>Yakutia and Taymyria, Russia: we sampled 78 surface sediments and a sediment core, extending to 7000 years before present, to capture the forest–tundra transition in space and time, respectively. </span></p> <p><span><b>Taxon</b></span></p> <p><span>Arctic freshwater diatoms.</span></p> <p><span><b>Methods</b></span></p> <p><span>We applied metabarcoding to retrieve diatom diversity from surface and core sedimentary DNA. The taxonomic assignment binned sequence types (lineages) into genera and created taxonomic (abundance of lineages within different genera) and phylogenetic datasets (phylogenetic distances of lineages within different genera).</span></p> <p><span><b>Results</b></span></p> <p><span>Contrary to our expectations, we find a unimodal relationship between phylogenetic distance and richness in diatom genera. We discern a positive relationship between phylogenetic distance and taxonomic turnover in spatially and temporally distributed diatom genera. Further, we reveal positive relatedness indices in diatom genera across the spatial environmental gradient and predominantly in time-slices at a single location, with very few exceptions assuming effects of competition. Distance-based ordination of taxonomic and phylogenetic turnover indicates that lake environment variables, like HCO<sub>3</sub><sup>–</sup> and water depth, largely explain diatom turnover. </span></p> <p><span><b>Main conclusion</b></span></p> <p>Phylogenetic and abiotic assembly rules are important in understanding the regional assembly of diatom genera across lakes in the Siberian treeline ecotone. Using a space–time approach we are able to exclude the influence of geography and elucidate that lake environmental variables primarily shape the assemblies. We conclude that some diatom genera have greater capabilities to adapt to environmental changes, whereas others will be putatively replaced or lost due to the displacement of the Arctic tundra biome under recent global warming.</p>
Marine Sedimentary Ancient DNA (sedaDNA) from the North Atlantic Ocean
<p>Filtered sedimentary ancient DNA data (megan files), that includes sequence counts per sample. Additionally, scripts for the correlation analysis and heatmap are included. </p>
High resolution ancient sedimentary DNA shows that alpine plant diversity is associated with human land use and climate change
<p>The European Alps are highly rich in species, but their future may be threatened by ongoing changes in human land use and climate. Here, we reconstructed vegetation, temperature, human impact and livestock over the past ~12,000 years from Lake Sulsseewli, based on sedimentary ancient plant and mammal DNA, pollen, spores, chironomids, and microcharcoal. We assembled a highly-complete local DNA reference library (PhyloAlps, 3,923 plant taxa), and used this to obtain an exceptionally rich <em>sed</em>aDNA record of 366 plant taxa. Vegetation mainly responded to climate during the early Holocene, while human activity had an additional influence on vegetation from 6 ka onwards. Land-use shifted from episodic grazing during the Neolithic and Bronze Age to agropastoralism in the Middle Ages. Associated human deforestation allowed the coexistence of plant species typically found at different elevational belts, leading to levels of plant richness that characterise the current high diversity of this region. Our findings indicate a positive association between low-intensity agropastoral activities and precipitation with the maintenance of the unique subalpine and alpine plant diversity of the European Alps.</p>
Sedimentary DNA of a human‐impacted lake in Western Canada (Cultus Lake) reveals changes in micro‐eukaryotic diversity over the past ~200 years
<p>Although the use of genetic analyses of sedimentary DNA to track changes in biodiversity has increased over the last decade, questions remain as to how well DNA captures past ecological conditions. Even less is known about how extracellular and intracellular DNA are archived in lake sediments and whether the two fractions yield similar information. Here we characterized the changes of micro‐eukaryotic communities over the past ~200 years in Cultus Lake (British Columbia, Canada), for which a rich body of limnological data and a pre‐existing multi‐proxy paleolimnological study exist. We generated and analyzed 18S rRNA gene amplicons and found that extracellular and intracellular DNA provided different insights, with the preservation of extracellular DNA compromised in sediments older than ~30 years. Principal Coordinates and indicator species analyses based on intracellular DNA showed that changes in micro‐eukaryotic diversity occurred at similar time periods as those identified with the classical paleolimnological study. For instance, decreases of Opisthokonta amplicons occurred during years with elevated numbers of sockeye salmon spawners, which might be associated with an increase of herbivory by juvenile sockeye salmon. Furthermore, two diatom species identified morphologically exhibited similar temporal dynamics to two diatom taxa identified genetically, suggesting that sedimentary DNA can track past diatom species changes as well as micro‐eukaryotic community changes. Overall, our study provides insights into the use of extracellular and intracellular DNA in sedimentary records and showed that sedimentary DNA enriches our understanding of micro‐eukaryotic community changes over centennial time scales.</p>
Inventory of ancient environmental DNA from sedimentary archives: locations, methods, and target taxa
<p>Locations of sampling sites from sedimentary ancient environmental DNA (aeDNA) studies. aeDNA is DNA that has degraded into short fragments, exhibits post-mortem damage signatures, and is recovered from a non-living tissue, organism, or environmental sample. Here we focus on sedimentary archives with contiguous records such as lake and marine sediments, permafrost, middens, cave sediments, soils, and incidental associated surface sediment samples used to interpret sedimentary archives. Studies span historic and ancient time periods using a variety of DNA-based methods (i.e., metabarcoding, shotgun sequencing, target capture, qPCR, ddPCR, and others) to study taxa from microorganisms to plants and mammals.</p>
Fungus and plant sedimentary ancient DNA metabarcoding data from five lakes in Siberia
Open the record for dataset details and reuse information.
Sedimentary DNA of a human‐impacted lake in Western Canada (Cultus Lake) reveals changes in micro‐eukaryotic diversity over the past ~200 years
Open the record for dataset details and reuse information.
High resolution ancient sedimentary DNA shows that alpine plant diversity is associated with human land use and climate change
Open the record for dataset details and reuse information.
Data from: The history of tree and shrub taxa on Bol'shoy Lyakhovsky Island (New Siberian Archipelago) since the last interglacial uncovered by sedimentary ancient DNA and pollen data
Open the record for dataset details and reuse information.
Millennia of metacommunity diversification and homogenization captured by sedimentary ancient DNA
Open the record for dataset details and reuse information.
Data from: Phylogenetic diversity and environment form assembly rules for Arctic diatom genera—a study on recent and ancient sedimentary DNA
Open the record for dataset details and reuse information.
Diatom sedimentary ancient DNA metabarcoding from western Fram Strait and Kronotsky Peninsula
<p>In this study we use sedimentary ancient DNA metabarcoding from two marine sediment cores. The first Kastenlot core MSM05/5-712-2 was taken at western Fram Strait (subarctic North Atlantic) from which we collected 12 samples including one biological replicate. The second Kastenlot core SO201-2-12KL was retrieved from Kamchatka Strait (subarctic North Pacific) from which we collected 9 samples and 2 samples were collected from a pilot core taken next to the Kastenlot core. Total DNA was extracted from approximately 2ml sediment per sample in 3 batches with up to 9 samples and one extraction blank. Total DNA was concentrated and if necessary diluted to 2.5 ng/µl. For each batch we performed PCRs in triplicates including a PCR no template control (NTC). We amplified a diatom-specific, 76 bp long part of the rbcL gene with tagged primers Diat_rbcL_705F (AACAGGTGAAGTTAAAGGTTCATAYTT) and Diat_rbcL_808R (TGTAACCCATAACTAAATCGATCAT). The PCR-products were purified and pooled in equal concentrations. The sequencing library was prepared with the Mid Output kit v. 2 according to the Fasteris Metafast protocol for low complexity amplicon sequencing and checked by qPCR. The library was sequenced (2 x 150 bp, paired-end) on the Illumina NextSeq 500 at the Fasteris SA sequencing service (Switzerland). For two samples we sequenced 4 PCR-products and for two samples we could only get 2 PCR-products with sufficient DNA content for sequencing.</p>
Plant sedimentary ancient DNA data from Far East Russia
<p>Woody plants are expanding into the Arctic in response to the warming climate. The impact on arctic plants is not well understood due to the limited knowledge about plant assembly rules. Past plant diversity over long time series is rare. Here, we applied sedimentary ancient DNA metabarcoding targeting the P6 loop of the chloroplast <i>trnL</i> gene to a sediment record from Lake Ilirney (central Chukotka, Far Eastern Russia) covering the last 28 thousand years. Our results show that forb-rich steppe-tundra and dwarf-shrub tundra dominated during the cold climate before 14 ka, while deciduous erect-shrub tundra was abundant during the warm period since 14 ka. <i>Larix</i> invasion during the late Holocene substantially lagged behind the likely warmest period between 10 and 6 ka, where the vegetation coverage was densest. We reveal highest richness during 28–23 ka and a second richness peak during 13–10 ka, with both periods being accompanied by low shrub abundance. During the cold period before 14 ka, rich communities were phylogenetically clustered, suggesting low genetic divergence in the communities despite the great number of species. This probably originates from environmental filtering along with niche differentiation due to limited resources under harsh environmental conditions. In contrast, during the warmer period after 14 ka, rich communities were phylogenetically overdispersed. This results from a high number of species which were found to harbor high genetic divergence, likely originating from an erratic recruitment process in the course of warming. Some of our evidence may be of relevance for inferring future arctic plant assembly rules and diversity changes. By analogy to the past, we expect a lagged response of tree invasion. Plant richness may overshoot in the short term; in the long-term, however, the ongoing expansion of deciduous shrubs will eventually result in a phylogenetically more diverse community.</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.