Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
23
datasets available to search
ShareScore release 0.9.0
Dataset results
23 results for “tambaqui”
Fig. 2. Relationships concentration x in Anesthesia of tambaqui Colossoma macropomum (Characiformes: Serrasalmidae) with the essential oils of Aniba rosaeodora and Aniba parviflora and their major compound, linalool
Fig. 2. Relationships concentration x anesthesia induction or recovery time in tambaqui, Colossoma macropomum, exposed to the linalools. a. synthetic linalool; light sedation: y=4.4+(4281/x), r2=0.716, deep sedation: y=-22.5+(12252/x), r2=0.773, deep anesthesia:y=15.3+(17878/x), r2=0.669, recovery: y=43.9+0.66x+0.0015x2, r2=0.712. b. linalool extracted from Aniba rosaeodora; deep sedation: y=29.0+(6010/x), r2=0.784, deep anesthesia: y=-151.3+(60541/x), r2=0.873. Light sedation and recovery: no significant relationship. y = time to reach stage or recovery (s) and x = concentration (µL L-1).
FIGURE 1. Notozothecium janauachensis n in Notozothecium janauachensis n. sp. (Monogenoidea: Dactylogyridae) from wild and cultured tambaqui, Colossoma macropomum (Teleostei: Characidae: Serrasalminae) in Brazil
FIGURE 1. Notozothecium janauachensis n. sp. 1. Composite illustration of adult, ventral view of specimen from the natural habitat. Scale bar 50 m.
Figure 6 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize
Figure 6. Regression Graph (linear model) for the variable coefficient: Apparent digestibility of crude protein for tambaqui fed diets with different particle size of corn (Ŷ = 72.2 – 1.21.X; (R2 = 52.0%; p= 0.0014)).
Figure 5 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize
Figure 5. Regression Graph (Quadratic Model) for the variable specific growth rate (TCE) after 68 days of experiment (Ŷ = 6.15 – 0.00279.X + 0.00000191.X2; (R2 = 53.7%; p= 0.0006)).
Figure 2 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize
Figure 2. Regression Graph (Model Quadratic) for variable weight gain in the 68 days of experiment (Ŷ = 61.3 – 0.0807.X + 0.0000574X2 (R2 = 58.5%; p= 0.0002)).
Figure 4 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize
Figure 4. Regression Graph (Quadratic Model) for variable Total feed consumption in the 68 days of experiment (Ŷ = 556.6 – 0.513.X + 0.000321.X2; (R2 = 65.6%; p<0.0001)).
Figure 3 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize
Figure 3. Regression Graph (Cubic Model) for apparent feed conversion variable after 68 days of experiment (Ŷ = 1.27 – 0.00284X + 0.00000783X2 – 0.00000000570X3; (R2 = 58.,1%; p= 0.0007)).
Figure 1 in Zootechnical indices and digestibility in juveniles of tambaqui Colossoma macropomum fed a diet containing particulate maize
Figure 1. Regression Graph (Model Quadratic) for variable weight final after 68 days of experiment (Ŷ = 72.3 – 0.809.X + 0.0000576X2; (R2 = 58.5%; p= 0.0002)).
Fig 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
Fig 1: Relative gene expression in tambaqui juveniles farmed in two Brazilian regions: Northern (Balbina; BA) and Southeast (Brumado; BRU). Different letters represent statistical differences between populations. The graphs show expression of A) hif-1α (p = 0.137), B) hsp-70 (p = 0.465), C) mstn (p = 0.907), D) ube3a (p = 0.205), E) ras (p = 0.041), F) cry-1 (p = 0.001), G) per-1 (p = 0.001), H) ogt (p = 0.001) and I) acly (p = 0.025).
Fig 3 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
Fig 3: IBR analyses of relative gene expression in Balbina (BA) and Brumado (BRU) populations. The IBR values are 42.7 (Balbina) and 6.79 (Brumado).
Fig 2 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
Fig 2: Heatmap of relative expression in Balbina (BA) and Brumado (BRU) populations. The colour scale ranges from blue (low transcript levels) to red (high transcript levels).
Development of a pressure shock protocol to induce triploidy in tambaqui Colossoma macropomum (Cuvier, 1816)
<p>Dataset on triploidization, fertilization, larval survival and growth rates from trials used to develop a pressure shock protocol to induce triploidy in tambaqui Colossoma macropomum (Cuvier, 1816)</p>
CS10 - Tambaqui production Brazil - economic effects of genomic control tools 2022
<p>Datasets for cost benefit analysis of the implementation of the genomic control technology Tambaplus parentesco for tambaqui production in Brazil.</p>
Table 1 in Colossoma macropomum (Characiformes: Serrasalmidae) adapted to new climate regime: differential gene expression from farmed tambaqui juveniles raised in subtropical and tropical regions
<p><b>Table 1:</b> Details of target genes (<i>hif-1α</i>, <i>hsp70</i>, <i>ras</i>, <i>mstn</i>, <i>acly</i>, <i>per-1</i>, <i>cry-1</i>, <i>ube3a</i> and <i>ogt</i>) and reference genes (<i>β- tubulin</i> and <i>β- actin</i>) primers.</p><table><tbody><tr><th><b>Gene</b></th><th><b>Length (bp)</b></th><th><b>R</b> <b>2</b></th><th><b>Efficiency (%)</b></th><th><b>Primers sequence (5ʹ-3ʹ) forward/reverse</b></th></tr></tbody><tbody><tr><th><i>tubulin</i> -F</th><td>20</td><td>0.99</td><td>109.5</td><td>GACGTGGTGCCCAAAGATGT</td></tr><tr><th><i>tubulin</i> -R</th><td>18</td><td>TGGATGGTGCGCTTGGT</td></tr><tr><th><i>β- actin</i> -F</th><td>21</td><td>0.99</td><td>100.5</td><td>GCTGTTTTCCCCTCCATTGTT</td></tr><tr><th><i>β- actin</i> -R</th><td>19</td><td>TCCCATGCCAACCATCACT</td></tr><tr><th><i>hif-1α</i> -F</th><td>20</td><td>0.99</td><td>105.2</td><td>CTTCTGAGCTCTGATGAGGC</td></tr><tr><th><i>hif-1α</i> -R</th><td>20</td><td>GAAAGCACCATCAGGAAGCC</td></tr><tr><th><i>hsp-70</i> -F</th><td>20</td><td>0.99</td><td>100.9</td><td>GCAAGGAGAACAAGATCACC</td></tr><tr><th><i>hsp-70</i> -R</th><td>19</td><td>CACTCCGTTGCACTTGTCC</td></tr><tr><th><i>mstn</i> -F</th><td>20</td><td>0.98</td><td>100.5</td><td>AATCCAAGCGAGGGAAAAGC</td></tr><tr><th><i>mstn</i> -R</th><td>22</td><td>CCTCCATCACCTGAAAGGTCTT</td></tr><tr><th><i>ras</i> -F</th><td>20</td><td>0.97</td><td>99.31</td><td>CCAGTACATGAGGACAGGAG</td></tr><tr><th><i>ras</i> -R</th><td>20</td><td>CAAGCACCATTGGCACATCG</td></tr><tr><th><i>acly</i> -F</th><td>19</td><td>0.99</td><td>100.7</td><td>ATCATCTCCCGCACTACAG</td></tr><tr><th><i>acly</i> -R</th><td>19</td><td>TACCTCCAATCTCTCCCAG</td></tr><tr><th><i>ube3a</i> -F</th><td>21</td><td>0.98</td><td>103.3</td><td>GCCATAAGCAAGCAGCACAAC</td></tr><tr><th><i>ube3a</i> -R</th><td>19</td><td>CCAGTCAGTCCGCACATCG</td></tr><tr><th><i>per-1</i> -F</th><td>20</td><td>0.98</td><td>104.1</td><td>TGTTGAAGTTTGTGCCCCAG</td></tr><tr><th><i>per-1</i> -R</th><td>18</td><td>CAGTCCAGATGCTCCTCC</td></tr><tr><th><i>cry-1</i> -F</th><td>19</td><td>0.99</td><td>103.6</td><td>GTCCAACAGCCCTCAAACT</td></tr><tr><th><i>cry-1</i> -R</th><td>18</td><td>TACGCCAAGCACTCCAGA</td></tr><tr><th><i>ogt</i> -F</th><td>19</td><td>0.99</td><td>104.1</td><td>CCTCCCTTTGCTGTGTTCC</td></tr><tr><th><i>ogt</i> -R</th><td>20</td><td>TGTCTGCTTTCCGCTTTCGC</td></tr></tbody></table>
Data from: Predicted 2100 climate scenarios affects growth and skeletal development of tambaqui (Colossoma macropomum) larvae
Climate changes driven by greenhouse gas emissions have been occurring in an accelerated degree, affecting environmental dynamics and living beings. Among all affected biomes, the Amazon is particularly subjected to adverse impacts, such as temperature rises and water acidification. This study aimed to evaluate the impacts of predicted climate change on initial growth and development of an important Amazonian food fish, the tambaqui. We analyzed growth performance, and monitored the initial osteogenic process and the emergence of skeletal anomalies, when larvae were exposed to three climate change scenarios: mild (B1, increase of 1.8 °C, 200 ppm of CO2); moderate (A1B, 2.8 °C, 400 ppm of CO2); and drastic (A2, 3.4 °C, 850 ppm of CO2 ), in addition to a control room that simulated the current climatic conditions of a pristine tropical forest . The exposure to climate change scenarios (B1, A1B and A2) resulted in low survival, especially for the animals exposed to A2, (24.7 ± 1.0 %). Zootechnical performance under the B1 and A1B scenarios was higher when compared to current and A2, except for condition factor, which was higher in current (2.64 ± 0.09) and A1B (2.41 ± 0.14) scenarios. However, skeletal analysis revealed higher incidences of abnormalities in larvae exposed to A1B (34.82 %) and A2 (39.91 %) scenarios when compared to current (15.38 %). Furthermore, the bone-staining process revealed that after 16 days post-hatch (7.8 ± 0.01 mm total length), skeletal structures were still cartilaginous, showing no mineralization in all scenarios. We concluded that tambaqui larvae are well-adapted to high temperatures and may survive mild climate change . However, facing more severe climate conditions, its initial development may be compromised, resulting in high mortality rates and increased incidence of skeletal anomalies, giving evidence that global climate change will hamper tambaqui larvae growth and skeletal ontogeny.
FIGURES 14–15 in Notozothecium janauachensis n. sp. (Monogenoidea: Dactylogyridae) from wild and cultured tambaqui, Colossoma macropomum (Teleostei: Characidae: Serrasalminae) in Brazil
FIGURES 14–15. Scanning electron micrographs of Notozothecium janauachensis n. sp. 14. Specimen showing the tegument with scaled annulations. 15. Specimen showing the dorsal vaginal aperture (V). Scale bars 50 m.
FIGURES 2–13. Notozothecium janauachensis n in Notozothecium janauachensis n. sp. (Monogenoidea: Dactylogyridae) from wild and cultured tambaqui, Colossoma macropomum (Teleostei: Characidae: Serrasalminae) in Brazil
FIGURES 2–13. Notozothecium janauachensis n. sp. 2. Copulatory complex, ventral view. 3. Copulatory complex, dorsal view. 4. Vagina and seminal receptacle, lateral view, right side. 5. Dorsal anchor. 6. Ventral anchor. 7. Dorsal bar. 8. Hook pair 1. 9. Hook pair 4. 10. Hook pair 5. 11. Hook pair 6. 12. Hook pair 7. 13. Ventral bar. Scale bar 20 m.
FIGURE 1. Notozothecium janauachensis n in Notozothecium janauachensis n. sp. (Monogenoidea: Dactylogyridae) from wild and cultured tambaqui, Colossoma macropomum (Teleostei: Characidae: Serrasalminae) in Brazil
FIGURE 1. Notozothecium janauachensis n. sp. 1. Composite illustration of adult, ventral view of specimen from the natural habitat. Scale bar 50 m.
Carbohydrate tolerance in Amazon tambaqui (Colossoma macropomum) revealed by NMR-metabolomics - Are glucose and fructose different sugars for fruit-eating fish?
<p>In the present study, two approaches were followed to evaluate the metabolic responses of tambaqui (Colossoma macropomum), a frugivorous species, to intraperitoneal (IP) administration of glucose (GLU) and fructose (FRU) in fed (FED) and 10-day fasted (FAST) esh. Glucose and fructose tolerance tests were performed to assess the car- bohydrate utilization and complementary NMR-metabolomics analyses were done to elucidate the impacts of sugar mobilization on the metabolic proele of plasma, liver and muscle. Blood was sampled from FED groups at 0, 3, 6 and 24 h; and at 0 and 24 h from FAST groups. Significant differences were observed in the hypergly- caemic peak between sugars at 3 h (GLU - 13.7 ± 2.0 mM vs. FRU - 8.7 ± 1.1 mM; saline 6.3 ± 0.6 mM) and on the return to normoglycaemia (GLU - 8.5 ± 2.2 mM vs. FRU - 5.2 ± 0.9 mM; saline 4.9 ± 0.6 mM) 6 h after IP on the FRU esh. The NMR-metabolomics approach allowed to conclude that tambaqui seems to be more re- sponsive to the feeding regime (FED vs. FAST) than to the injected sugar (FRU vs. GLU). From the studied tissues, plasma showed no significant variations between feeding regimes at 24 h after IP, while muscle and liver re- vealed some variations on the enal metabolome proele between FED and FAST groups. The metabolome varia- tions between feeding regimes are indicative of changes on the amino acid utilization. Fish from FAST group seem to utilize amino acids as energy source rather than for protein synthesis and muscle growth. Variations on glucose concentration in muscle can also indicate different utilization of the sugars depending on the feeding regime.</p>
Data from: Predicted 2100 climate scenarios affects growth and skeletal development of tambaqui (Colossoma macropomum) larvae
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.