Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,696
datasets available to search
ShareScore release 0.9.0
Dataset results
3,696 results for “reference”
FIGURE 6 in Taxonomy and nomenclature of Kalanchoe beharensis (Crassulaceae subfam. Kalanchooideae), a variable, arborescent species from Madagascar, with reference to its horticultural derivatives
FIGURE 6. Kalanchoe ×edwardii 'Roseleaf' [K. beharensis × K. tomentosa]. A. A juvenile specimen with a khaki-green leaf colour as a result of exposure to high levels of solar irradiation. B. The abaxial leaf surface lacks wart-like protuberances. C. Apical portion of the terminally-borne inflorescence of K. ×edwardii 'Roseleaf'. D. The greenish, tomentose flowers are strongly pink-infused—more so than in the case of K. ×edwardii 'Fang'—with a network of purplish pink veins visible on the adaxial corolla lobe surface. All photographs: Gideon F. Smith.
FIGURE 1 in Taxonomy and nomenclature of Kalanchoe beharensis (Crassulaceae subfam. Kalanchooideae), a variable, arborescent species from Madagascar, with reference to its horticultural derivatives
FIGURE 1. The nothospecies Kalanchoe ×kewensis that was bred at the Royal Botanic Gardens, Kew, more than 120 years ago is still available in the horticultural trade. The thick, succulent leaves of plants of this nothospecies have an interesting harpoon-shaped outline. Photograph: Gideon F. Smith.
FIGURE 4 in Taxonomy and nomenclature of Kalanchoe beharensis (Crassulaceae subfam. Kalanchooideae), a variable, arborescent species from Madagascar, with reference to its horticultural derivatives
FIGURE 4. Kalanchoe ×hummeliae 'Fernleaf' [K. beharensis × K. millotii]. A. Growing in a border (foreground) of the Blue Garden in the Ganna Walska Lotusland Botanical Garden, Montecito, California, U.S.A. (see Smith & Figueiredo 2014: 245, Adams 2015, and Romerein & Smith 2022: 172–179). B. In full sun the densely pubescent leaves take on a golden-bronze colour, while in shade the leaves are (C) silver-white. D. Terminal portion of an inflorescence. E. & F. Comparison of the flowers of K. beharensis (throughout the flower on the left), K. ×hummeliae 'Fernleaf' (throughout the flower in the centre), and K. millotii (throughout the flower on the right). E. Lateral view. F. Colour and patterning of the adaxial corolla lobe surface. All photographs: Gideon F. Smith.
FIGURE 5 in Taxonomy and nomenclature of Kalanchoe beharensis (Crassulaceae subfam. Kalanchooideae), a variable, arborescent species from Madagascar, with reference to its horticultural derivatives
FIGURE 5. Kalanchoe ×edwardii 'Fang' [K. beharensis × K. tomentosa]. A. A juvenile specimen with a coppery brown leaf colour as a result of exposure to high levels of solar irradiation. B. Especially the abaxial leaf surface is adorned with brown-tipped, wart-like protuberances. C. Inflorescences of K. ×edwardii 'Fang' are borne terminally. D. The tomentose flowers are greenish with a network of purplish pink veins visible on the adaxial corolla lobe surface. All photographs: Gideon F. Smith.
FIGURE 3. A. A in Taxonomy and nomenclature of Kalanchoe beharensis (Crassulaceae subfam. Kalanchooideae), a variable, arborescent species from Madagascar, with reference to its horticultural derivatives
FIGURE 3. A. A dense stand of Kalanchoe beharensis. B. Close-up of the stem of K. beharensis. C. Although variable, the leaf blades of most variants of K. beharensis are somewhat elongated-triangular, deltoid to peltate, and irregularly folded lengthwise and also in width. D. A severed leaf of K. beharensis that developed numerous small plantlets at the proximal end of the petiole. E. In winter, K. beharensis bears a much-branched, laterally-borne inflorescence. F. The corolla lobes K. beharensis are more or less recurved—sometimes strongly so—and greenish pink to pale yellow to yellowish green with prominent longitudinal, reddish purple stripes. The basally fused, elongatedtriangular sepals obscure most of the corolla tube. All photographs: Gideon F. Smith.
Fig. 1 in High-Throughput Sequencing for Life-History Sorting and for Bridging Reference Sequences in Marine Gerromorpha (Insecta: Heteroptera)
Fig. 1. Representative images of Halobates species collected (rows), and their various life stages (columns). (Top row) Halobates calyptus: nymph (A), adult male (B), and adult female (C); (middle row) Halobates hayanus: nymph (D), adult male (E), and adult female (F); (bottom row) Halobates maculatus: nymph (G), adult male (H) and adult female (I). All images are scaled to size, and black scale bars represent 1 mm.
Fig. 4 in High-Throughput Sequencing for Life-History Sorting and for Bridging Reference Sequences in Marine Gerromorpha (Insecta: Heteroptera)
Fig. 4. Maximum likelihood reconstruction (rooted to Rhagovelia antilleana) of 738 marine Gerromorpha samples using the 658-bp COI gene, collapsed into clades representing 10 species units (colored blocks) partitioned by ASAP (Puillandre et al. 2021) and PTP (Kapli et al. 2017; Zhang et al. 2013). mPTP posterior probabilities are denoted on the branches. Colors indicate the final species units (i.e., nine) delineated in this study after preliminary investigations found no morphological differences in H. maculatus clades.
Extended reference scenarios (ERS) files (including NLTE input and uncertainty perturbations)
<p>Extended reference scenarios (ERS) files (including NLTE input and uncertainty perturbations) for CAIRT studies.</p> <div> <p>The dataset includes essentially all the atmospheric input (based on ERS <span><a href="../records/10022129"><span>https://zenodo.org/records/10022129</span></a></span>) required to perform the GRANADA NLTE and KOPRA radiance simulations used in the CAIRT tomographic linear error analysis. This includes the input for unperturbed and perturbed NLTE and radiance simulations, the latter referring to perturbations of atmospheric parameters (CO2, O, T>120 km) and NLTE kinetic parameters. </p> </div> <div> <p>The data files are ascii files with the following naming <month>_<latitude>_<parameters>[_ngt][_hs][_hv][_<perturbation>].dat with parameters = pT, vmr, npar, ratio; _ngt for night (day has no suffix); _hs for ‘high solar’ (low solar has no suffix); _hv for high volcanic aerosol load (low volcanic has no suffix); <perturbations> refers to all perturbed atmospheric and NLTE parameters assessed in the error calculations (unperturbed has no suffix). </p> </div> <div> <p>parameter=ratio are the NLTE population files produced by GRANADA and read by KOPRA</p> <p>parameter=pT are pressure and temperature as in ERS (<span><a href="../records/10022129"><span>https://zenodo.org/records/10022129</span></a></span>) </p> </div> <div> <p>parameter=vmr includes vmr profiles of the ERS, but has in addition vmr profiles that are required for NLTE modeling (i.e., OH, HO2, N4S, N2D, H, O1D). It also includes some additional minor species not provided in the ERS which have been considered in the KOPRA radiative transfer calculations. Data sources for these profiles are specified within the files.</p> </div> <div> <p>parameter=npar are photolysis rates needed for the NLTE calculations, computed with the MIPAS preprocessor (invoking TUV).</p> </div>
A master list of all indicators and metrics, with definitions, ecosystem status component(s) they inform, and source references
<p><span>Global policies increasingly focus on the importance of maintaining or improving the integrity of ecosystems, but defining, assessing, and monitoring </span><span>integrity<span> in marine protected areas (MPAs) remains a challenge.</span> <span>In this paper, we conceptualized ecological integrity along dimensions </span>of <span>heterogeneity and stability containing seven components</span>: <span>physical structure, diversity, function, persistence, resistance, resilience, and natural variability. Through a structured literature search, we identified indicators and metrics used for quantifying ecosystem status components in the marine environment, then reviewed </span>MPA management plans worldwide for <span>inclusion of these components.</span> We evaluated <span>202 papers applying 83 ecological indicators built from 72 </span>metrics. Ecosystem components were most comprehensively addressed by metrics of taxa presence, organisms count, and area occupied by benthic organisms, and community structure, biomass, and percent cover indicators. <span>Of the 557 MPA management plans </span>we reviewed globally<span>, 93% used at least one ecosystem status term or its synonym in an ecologically-relevant context, but 39% did not address any components of stability. In particular, resistance was mentioned in only 1% of management plans, but in some cases it may be inferred from indicators and metrics used to track the best addressed component in management plans – diversity.</span> <span>Plans for MPAs with both an ecological/biological purpose and a research and education purpose contained ecosystem status terms more frequently than other plans, suggesting that engagement with the scientific community may have improved application of these terms.</span> <span>An improved understanding of how to operationalize and measure ecological integrity can help MPA monitoring and management.</span></span></p>
Dataset for Global Reference Seismological Data Sets: Multimode Surface Wave Dispersion
<ul> <li><strong>How fast do surface waves travel globally after any earthquake?</strong></li> <li><strong>Do we get the same information from various measurement techniques?</strong></li> <li><strong>Which features in the Earth are robust and can be resolved by a reference model?</strong></li> </ul> <p>Reference data with uncertainties are useful for improving existing measurement techniques, validating models of interior structure, calculating teleseismic data corrections in local or multiscale investigations and developing a 3-D reference Earth model. This study was done in collaboration with 18 scientists from 16 institutions in 7 countries who actively participated in the <a href="http://rem3d.org">REM3D</a> project. The project assimilated, archived, reconciled and modeled big (>200 million measurements) and diverse <a href="https://globalseismology.princeton.edu/data/surface-waves">surface-wave datasets</a> for global subsurface structure.</p> <p>The reference data set summarizes measurements of dispersion of fundamental-mode surface waves and up to six overtone branches from 44,871 earthquakes recorded on 12,222 globally distributed seismographic stations. Dispersion curves are specified at a set of reference periods between 25 and 250 s to determine propagation-phase anomalies with respect to a reference Earth model. Empirically determined observational uncertainties (1 sigma) for each wave type, branch number and period can be found in Table 3. </p> <p><strong>Summary:</strong></p> <p><strong>[I]</strong> <strong>Reconciled large and diverse catalogues</strong> of Love-wave (49.65 million) and Rayleigh-wave dispersion (177.66 million) from eight groups worldwide.<br> <strong>[II]</strong> Retrieved missing station and earthquake <strong>metadata</strong> in several legacy compilations and codified <strong>scalable formats</strong> to facilitate reproducibility, easy storage and fast I/O on HPC systems.<br> <strong>[III]</strong> <strong>Systematic discrepancies </strong>between raw phase anomalies can be attributed to discrepant theoretical approximations, reference Earth models and processing schemes.<br> <strong>[IV]</strong> <strong>Phase-velocity variations</strong> yielded by the inversion of the summary data set are <strong>highly correlated</strong> (R ≥ 0.8) with those from the quality-controlled contributing data sets, especially for long-wavelength variations (up to degree ∼25) in fundamental-mode dispersion (50–100 s).<br> <strong>[IV]</strong> <strong>Only 2ζ azimuthal variations</strong> in phase velocity of <strong>fundamental-mode Rayleigh waves</strong> are <strong>required</strong>; maps of 2ζ azimuthal variations are highly consistent between catalogues ( R = 0.6–0.8).</p> <p><strong>Feedback/Questions?</strong> Please contact Raj Moulik (<a href="https://rajmoulik.com">rajmoulik.com</a>) at <a href="mailto:moulik@caa.columbia.edu?subject=Query%20from%20Zenodo">moulik@caa.columbia.edu</a> </p> <p><strong>Reference:</strong></p> <p><em>Please cite the following work if you use this data or software.</em></p> <ul> <li>Moulik, P. <em>et al., </em>(2022) Global reference seismological data sets: multimode surface wave dispersion. <em>Geophys J Int</em> <strong>228</strong>, 1808–1849, doi: <a href="https://doi.org/10.1093/gji/ggab418">10.1093/gji/ggab418</a>. <em><a href="https://rajmoulik.com/Publications/Moulik_Reference_Surface_Waves_GJI2022.pdf">pdf</a></em></li> </ul> <p><em>You can also cite the dataset and software from this Zenodo page (Optional).</em></p> <ul> <li> <p>Moulik, P. (2022) Dataset for Global Reference Seismological Data Sets: Multimode Surface Wave Dispersion. In Geophys. J. Int. (v1.0, Vol. 228, pp. 1808–1849). Zenodo. doi: <a href="https://doi.org/10.5281/zenodo.8371228">10.5281/zenodo.8371228</a></p> </li> </ul> <p><strong>HDF5 Container Format</strong></p> <ul> <li><strong>Reference Love waves </strong>(<a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.SW.Love.data.h5">Download All Periods and Branches as Summary.SW.Love.data.h5</a>)</li> <li><strong>Reference Rayleigh waves </strong>(<a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.SW.Rayl.data.h5">Download All Periods and Branches as Summary.SW.Rayl.data.h5</a>)</li> </ul> <p>Summary (reference) data between pairs of 2562 evenly-spaced knot points with an average spacing of 4.33◦. These files store the data in the RSDF HDF5 container format. These can be read using standard HDF5 modules (e.g. h5py) or using <a href="http://avni.globalseismology.org/">AVNI</a>. For example, to read the reference data for fundamental mode R1 waves at 100s into a Pandas Dataframe containing data (df['data']) and a dictionary with the metadata (df['metadata']), and thereafter write contents to an ASCII text file, enter the following in Python:</p> <ul> <li><em>from avni.data.SW import readSWhdf5,writeSWascii</em></li> <li><em>df=readSWhdf5(query='0/100.0/R1/REM3D',hdffile='Summary.SW.Rayl.data.h5',datatype='summary')</em></li> <li><em>writeSWascii(df,'test.txt')</em></li> </ul> <p><strong>ASCII (text) Format</strong></p> <p>These files contain the same reference data as the HDF5 files above but in gzipped ASCII files. The files are named according to the overtone branch, wave type and period as <em>Summary.$overtone.$wave.$period.REM3D.gz</em> Table A1 from the paper describes the various columns in the surface-wave RSDF ASCII format files.</p> <ul> <li><strong>Love waves </strong>(<a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.SW.Love.data.zip">Download All Periods and Branches as Summary.SW.Love.data.zip</a>) <ul> <li>Fundamental Modes <ul> <li>Minor Arc Arrivals (L1) at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.25s.REM3D.gz">25s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.27s.REM3D.gz">27s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.30s.REM3D.gz">30s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.32s.REM3D.gz">32s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.35s.REM3D.gz">35s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.60s.REM3D.gz">60s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.75s.REM3D.gz">75s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.100s.REM3D.gz">100s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.125s.REM3D.gz">125s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L1.250s.REM3D.gz">250s</a></li> <li>Major Arc Arrivals (L2) at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L2.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L2.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L2.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L2.250s.REM3D.gz">250s</a></li> <li>Higher Obit Arrivals - L3 at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L3.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L3.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L3.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L3.250s.REM3D.gz">250s</a>; L4 at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L4.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L4.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L4.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L4.250s.REM3D.gz">250s</a>; L5 at at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L5.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L5.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L5.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.L5.250s.REM3D.gz">250s</a>.</li> </ul> </li> <li>I<sup>st</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.60s.REM3D.gz">60s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.75s.REM3D.gz">75s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.100s.REM3D.gz">100s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.125s.REM3D.gz">125s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.175s.REM3D.gz">175s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.L1.200s.REM3D.gz">200s</a></li> <li>II<sup>nd</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.60s.REM3D.gz">60s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.75s.REM3D.gz">75s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.100s.REM3D.gz">100s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.125s.REM3D.gz">125s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.L1.150s.REM3D.gz">150s</a></li> <li>III<sup>rd</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.L1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.L1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.L1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.L1.60s.REM3D.gz">60s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.L1.75s.REM3D.gz">75s</a></li> <li>IV<sup>th</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.L1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.L1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.L1.50s.REM3D.gz">50s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.L1.60s.REM3D.gz">60s</a></li> <li>V<sup>th</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.5.L1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.5.L1.45s.REM3D.gz">45s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.5.L1.50s.REM3D.gz">50s</a></li> </ul> </li> <li><strong>Rayleigh waves </strong>(<a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.SW.Rayl.data.zip">Download All Periods and Branches as Summary.SW.Rayl.data.zip</a>) <ul> <li>Fundamental Modes <ul> <li>Minor Arc Arrivals (R1) at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.25s.REM3D.gz">25s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.27s.REM3D.gz">27s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.30s.REM3D.gz">30s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.32s.REM3D.gz">32s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.35s.REM3D.gz">35s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.60s.REM3D.gz">60s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.75s.REM3D.gz">75s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.100s.REM3D.gz">100s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.125s.REM3D.gz">125s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R1.250s.REM3D.gz">250s</a></li> <li>Major Arc Arrivals (R2) at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R2.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R2.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R2.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R2.250s.REM3D.gz">250s</a></li> <li>Higher Obit Arrivals - R3 at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R3.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R3.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R3.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R3.250s.REM3D.gz">250s</a>; R4 at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R4.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R4.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R4.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R4.250s.REM3D.gz">250s</a>; R5 at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R5.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R5.175s.REM3D.gz">175s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R5.200s.REM3D.gz">200s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.0.R5.250s.REM3D.gz">250s</a>.</li> </ul> </li> <li>I<sup>st</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.60s.REM3D.gz">60s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.75s.REM3D.gz">75s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.100s.REM3D.gz">100s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.125s.REM3D.gz">125s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.150s.REM3D.gz">150s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.175s.REM3D.gz">175s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.1.R1.200s.REM3D.gz">200s</a></li> <li>II<sup>nd</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.60s.REM3D.gz">60s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.75s.REM3D.gz">75s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.100s.REM3D.gz">100s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.125s.REM3D.gz">125s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.2.R1.150s.REM3D.gz">150s</a></li> <li>III<sup>rd</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.R1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.R1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.R1.50s.REM3D.gz">50s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.R1.60s.REM3D.gz">60s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.3.R1.75s.REM3D.gz">75s</a></li> <li>IV<sup>th</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.R1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.R1.45s.REM3D.gz">45s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.R1.50s.REM3D.gz">50s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.4.R1.60s.REM3D.gz">60s</a></li> <li>V<sup>th</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.5.R1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.5.R1.45s.REM3D.gz">45s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.5.R1.50s.REM3D.gz">50s</a></li> <li>VI<sup>th</sup> Overtone at <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.6.R1.40s.REM3D.gz">40s</a>, <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.6.R1.45s.REM3D.gz">45s</a>, and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Summary.6.R1.50s.REM3D.gz">50s</a></li> </ul> </li> </ul> <p><strong>Other Data Products:</strong></p> <ul> </ul> <ul> <li><strong>ReferenceSW_Moulik2022_Figures(<a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/ReferenceSW_Moulik2022_Figures.zip">.zip</a> or <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/ReferenceSW_Moulik2022_Figures.pdf">.pdf</a>)</strong> - contains all figures from the paper in .png format</li> <li><a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Scatter_Plots.zip"><strong>Scatter_Plots.zip</strong></a> - contains scatter plots similar to Figure 5 in the paper, which compares measurements between two sets of techniques. The files with the suffix *raw.png are comparisons for original raw datasets, while those with the suffix *.clean.png are comparisons after the entire workflow is completed to create the clean datasets (e.g. Figure 13, bottom row).</li> <li><a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Half_cycle.zip"><strong>Half_cycle.zip</strong></a> and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Cycle_skips.zip"><strong>Cycle_skips.zip</strong></a> - contains list of source-station paths where discrepancies were found between pairs of techniques. Half (±0.9–1.1 · π ) or full-cycle discrepancies (±0.9–1.1 · 2π ) identified in Section 4.5 are used during outlier analysis (Section 5.3) to create the clean summary dataset. Half- and full-cycle discrepancies identified in these files indicate potential polarity reversals and cycle skips respectively. Note that all of these discrepancies have not been checked for specific causes manually. </li> <li><a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/vflip-table.REM3D"><strong>vflip-table.REM3D</strong></a> - an ASCII file containing station names and start/end times where polarity reversal issues have been confirmed through manual analysis. This is in contrast to the automated half-cycle discrepancies identified in <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Half_cycle.zip"><strong>Half_cycle.zip</strong></a> above.</li> <li><a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/M1442"><strong>M1442</strong></a> and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/B2562"><strong>B2562</strong></a> - Files containing the knot locations of evenly-spaced points on the surface. B2562 has an average knot spacing of 4.33◦ and is used as the underlying grid for the homogenization process to get summary data (Section 5.1). In order to obtain 2-D variations in local phase slowness or velocity, we use 1442 splines with an average knot spacing of 5.77◦ (Section 6.1)</li> <li><a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Cleanhomo.SW.Love.data.h5"><strong>Cleanhomo.SW.Love.data.h5</strong></a> and <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Cleanhomo.SW.Rayl.data.h5"><strong>Cleanhomo.SW.Rayl.data.h5</strong></a> - Clean homogenized data for each research group obtained at the end of our workflow (Figure 2). The ASCII files containing the same data are provided in <a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Cleanhomo.SW.Love.data.zip"><strong>Cleanhomo.SW.Love.data.zip</strong></a> and <strong><a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Cleanhomo.SW.Rayl.data.zip">Cleanhomo.SW.Rayl.data.zip</a>. </strong>The summary dataset listed earlier represents the reconciled measurements, and should be preferred over those from individual groups in most applications.</li> <li><a href="https://zenodo.org/api/files/e41385bf-fc0d-46ff-ac4b-4fb101467c6c/Inversion_Example.zip"><strong>Inversion_Example.zip</strong></a> - Contains an example of a 2D slowness map inversion with 2ζ azimuthal variations using the reference summary dataset at 100s for fundamental-mode minor-arc Rayleigh waves (R1). Also provided are plots for anistropic variation (<em>Anisotropy_Plots</em>), spline coeffients of 1442 evenly-spaced spherical splines (<em>Spline_Coefficients</em>), and corresponding values at every 1X1 degree pixel in extended pixel format (<em>Maps_epix</em>). The aim of this study is to provide dispersion measurements of surface-wave arrivals, not to provide detailed 2D phase velocity/slowness models. </li> </ul> <p><strong>Note about Data Format</strong></p> <p>The underlying philosophy and format of data files are discussed in the <a href="https://globalseismology.princeton.edu/rsdf">reference seismic data format (RSDF) project</a>. Table A1 from the GJI paper describes the various columns in the surface-wave RSDF format files above.</p>
Data for: Consistently heterogeneous structures observed at multiple spatial scales across fire-intact reference sites
<p>Geospatial polygons representing fire-suppressed control sites against which fire-intact reference sites were compared in Chamberlain et al. (2023). Control sites represent areas with 1) no record of fire history, 2) no record of late 20th century or early 21st century timber management, and 3) no "Fast Change" detected by the Landscape Change Monitoring System dataset. All sites are predominantly within the yellow pine and mixed-conifer zone of California's Sierra Nevada, USA. Polygon boundaries were defined using the NHDPlusV2 catchments, and were manually reshaped using aerial imagery to ensure that polygons were > 100 ha, represented primarily forested areas, and excluded major roads, infrastructure, and major rock outcrops.</p> <p>Detailed description of the methods used to produce this dataset provided in:<br> Chamberlain, C.P., Cova, G.R., Cansler, C.A., North, M.P., Meyer, M.D., Jeronimo, S.M.A., Kane, V.R., 2023. Consistently heterogeneous structures observed at multiple spatial scales across fire-intact reference sites. Forest Ecology and Management.</p>
Rockfish chromosome reference assemblies (Kolora et al 2021)
<p>Rockfish chromosome reference assemblies from Kolora et al 2021. These are also uploaded on NCBI however NCBI renamed the contigs making them incompatible with the annotation GFFs. These references have the original contig names and are thus compatible with the annotation GFFs found here https://doi.org/10.5281/zenodo.5534983.</p>
rCRUX Generated rbcl (Plant RBCL7/8) Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: rbcl (Plant RBCL7/8)<br> Gene: rbcl<br> Length of Target: 180<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 150<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CTCCTGAMTAYGAAACCAAAGA<br> Reverse Sequence (5'-3'): GTAGCAGCGCCCTTTGTAAC<br> Reference: McFrederick, Q. S., and S. M. Rehan (2016). Characterization of pollen and bacterial community composition in brood provisions of a small carpenter bee. Molecular Ecology 25:2302–2311. https://doi.org/10.1111/mec.13608 & Spence, A. R., Wilson Rankin, E. E., & Tingley, M. W. (2022). DNA metabarcoding reveals broadly overlapping diets in three sympatric North American hummingbirds. The Auk, 139(1), ukab074. http://dx.doi.org/10.1093/auk/uky003</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
References and Climatic data of the different study sites of the Moroccan Mountains
<p>This Dataset present the Precipitation and Temperature of different study sites and the references used in the article: "Pollen indices of C. atlantica M. populations vary with climatic changes in the Moroccan Mountains" </p>
EUParlspeech: A Dataset of Over 1 Million References to European Integration in Parliamentary Speeches
<p>As part of my PhD dissertation I developed EUParlspeech, a dataset of over 1 million references to European integration made in the plenary debates of ten national parliaments between 1989 and 2019. It is built from existing datasets of parliamentary speeches, most notably Parlspeech (Rauh and Schwalbach 2020). The dataset has applications for scholars of EU integration, party competition, political communication, and international relations. This chapter in my dissertation explains the construction of the dataset, describes its features, and demonstrates its face, convergent, and predictive validity. Automated analysis of parties' EU statements in parliament yield meaningful and well-known cross party differences, with challenger parties more likely to send clearer, more sceptical cues on integration than mainstream parties. Moreover, these automated measures correlate highly with expert assessments (CHES) and - in the case of the UK's Conservative Party - individual MPs' ideal point estimates based on EU statements in plenary debates can predict their subsequent vote and position at the 2016 referendum. I conclude that EUParlspeech data provide a promising new approach to studying party contestation over European integration.</p>
Figure 10. Saltoposuchus connectens referred specimen SMNS 12352. A, SMNS 12352a in A revision and histological investigation of Saltoposuchus connectens (Archosauria: Crocodylomorpha) from the Norian (Late Triassic) of south-western Germany
Figure 10. Saltoposuchus connectens referred specimen SMNS 12352. A, SMNS 12352a with the snout region exposed in angled right lateral view; B, interpretative drawing of (A); C, opposite side of SMNS 12352a exposing the posterior portion of the less maxilla and lacrimal in angled lateral view; D, interpretative drawing of (C); E, SMNS 12352b, carpus and manus in dorsal view; F, interpretative drawing of (E); G, SMNS 12352b in medial view; H, interpretative drawing of (G). Abbreviations; antfe, antorbital fenestra; antfo, antorbital fossa; dc, distal carpal; de, dentary; exp, extensor pit; fr, frontal; j, jugal; la, lacrimal; lad, lacrimal duct; mc, metacarpal; mx, maxilla; na, nasal; ph, phalanx; pm, premaxilla; prf, prefrontal; ra, radiale; ul, ulnare.
Figure 9. Saltoposuchus connectens referred specimen SMNS 12591a. A in A revision and histological investigation of Saltoposuchus connectens (Archosauria: Crocodylomorpha) from the Norian (Late Triassic) of south-western Germany
Figure 9. Saltoposuchus connectens referred specimen SMNS 12591a. A, skull and mandible in dorsal view; B, interpretative drawing of (A); C, ventral view; D, interpretative drawing of (C). Abbreviations: an, angular; antfo, antorbital fossa; bpp, basipterygoid process; crb, ceratobranchial I; de, dentary; ect, ectopterygoid; fr, frontal; j, jugal; la, lacrimal; mx, maxilla; na, nasal; pa, parietal; pbs, parabasisphenoid; pl, palatine; plf, palatine fossa; po, postorbital; pra, pre-articular; prf, prefrontal; pt, pterygoid; ptmr, pterygoid medial rim; sa, surangular; spl, splenial; sq, squamosal; vo, vomer.
Figure 7. Saltoposuchus connectens referred specimen SMNS 55009, continued. A, B, C, D, E, F, SMNS 55009e in A revision and histological investigation of Saltoposuchus connectens (Archosauria: Crocodylomorpha) from the Norian (Late Triassic) of south-western Germany
Figure 7. Saltoposuchus connectens referred specimen SMNS 55009, continued. A, B, C, D, E, F, SMNS 55009e, right tibia in (A) posterior, (B) anterior, (C) medial, (D) lateral, (E) proximal, and (F) distal views; G, H, SMNS 55009h, metatarsal block in (G) dorsal(?) and (H) opposing views; I, J, K, L, SMNS 55009g, right calcaneum in (I) medial, (J) lateral, (K) proximal, and (L) distal views. Abbreviations: als, anterolateral side; asf, astragalus facet; calt, calcaneal tuber; gr, groove; latc, lateral condyle; lg, longitudinal groove; mt, metatarsal; no, notch; pme, posterior extension; pms, posteromedial side; tr, trough.
Figure 8. Saltoposuchus connectens referred specimen SMNS 12591a. A in A revision and histological investigation of Saltoposuchus connectens (Archosauria: Crocodylomorpha) from the Norian (Late Triassic) of south-western Germany
Figure 8. Saltoposuchus connectens referred specimen SMNS 12591a. A, skull and mandible in right lateral view; B, interpretative drawing of A; C, less lateral view; D, interpretative drawing of (C). Abbreviations: an, angular; cc, crista cranii; de, dentary; fr, frontal; j, jugal; la, lacrimal; ls, laterosphenoid; mx, maxilla; na, nasal; pa, parietal; pl, palatine; po, postorbital; prf, prefrontal; pt, pterygoid; q, quadrate; qj, quadratojugal; sa, surangular; sq, squamosal.
Figure 5. Saltoposuchus connectens referred specimen SMNS 12596, continued. A, B, SMNS 12596g in A revision and histological investigation of Saltoposuchus connectens (Archosauria: Crocodylomorpha) from the Norian (Late Triassic) of south-western Germany
Figure 5. Saltoposuchus connectens referred specimen SMNS 12596, continued. A, B, SMNS 12596g, right pubis in (A) anterior and (B) angled medial views; C, SMNS 12596h, right ischium exposed in dorsomedial view and two proximal caudal vertebrae exposed in dorsal view; D, SMNS 12596i, tentative less ulna in posteromedial view; E, F, G, H, SMNS 12596j, right femur in (E) posteromedial, (F) anterolateral, (G) proximal, and (H) distal views; I, proximal half of the right femur in posterolateral view; J, K, SMNS 12596k, right tibia and fibula, (J) with the tibia in posteromedial and the fibula in lateral(?) view and (K) with the tibia in anterolateral and the fibula in medial(?) view. Abbreviations: alcr, anterolateral crest; amt, anteromedial tuber; car, caudal rib; cav, caudal vertebra; cr, crest; crtf, crista tibiofibularis; fi, fibula; gr, groove; ilf, ilium facet; iss, ischial shass; lc, lateral condyle; ltr, lesser trochanter; mc, medial condyle; no, notch; ns, neural spine; obf, obturator foramen; olp, olecranon process; os, osteoderm; poz, postzygapophysis; pr., proximal; prz, prezygapophysis; pus, pubic shass; put, pubic tubercle; r., right; ti, tibia; tr, trochanter.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.