Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,584
datasets available to search
ShareScore release 0.9.0
Dataset results
3,584 results for “genomic analysis”
RadioGx: Analysis of Large-Scale Radio-Genomic Data
<p>This dataset contains an index of RadioSet objects available for download using the RadioGx R package. Each of the RSet objects are hosted in their own separate Zenodo uploads. The RadioGx R package is available for download from Bioconductor.</p>
Genomic analysis of the diversity, antimicrobial resistance and virulence potential of Campylobacter jejuni and Campylobacter coli strains from a private health care center in Central Chile
<p>Supplementary Dataset for the work entitled "Genomic analysis of the diversity, antimicrobial resistance and virulence potential of Campylobacter jejuni and Campylobacter coli strains from a private health care center in Central Chile".</p> <p>This dataset includes bacterial draft genome sequence reannotations of 69 C. jejuni and 12 C. coli strains, the fasta file containing the nucleotide sequence of <em>Campylobacter</em> pathogenicity genes screened for the virulome analysis and the fasta file for the in-house database for plasmid screening analysis in <em>Campylobacter </em>genomes.</p>
Conservation genomic analysis of the Croatian indigenous Black Slavonian and Turopolje pig breeds
<p>The majority of the nearly 400 existing local pig breeds are adapted to specific environments and human needs. The demand for large production quantities and the industrialized pig production have caused a rapid decline of many local pig breeds in recent decades. Black Slavonian pig and Turopolje pig, the latter highly threatened, are the two Croatian local indigenous breeds typically grown in extensive or semi-intensive systems. In order to guide a long-term breeding program to prevent the disappearance of these breeds, we analyzed their genetic diversity, inbreeding level and relationship with other local breeds across the world, as well as modern breeds and several wild populations, using high throughput genomic data obtained using the Illumina Infinium PorcineSNP60 v2 BeadChip. Multidimensional scaling analysis positioned Black Slavonian pigs close to the UK/North American breeds, while the Turopolje pig clustered within the Mediterranean breeds. Turopolje pig showed a very high inbreeding level (F<sub>ROH>4Mb</sub>=0.400 and F<sub>ROH>8Mb</sub>=0.332) that considerably exceeded the level of full-sib mating, while Black Slavonian pig showed much lower inbreeding (F<sub>ROH>4Mb</sub>=0.098 and F<sub>ROH>8Mb</sub>=0.074), indicating a planned mating strategy. In Croatian local breeds we identified several genome regions showing adaptive selection signals that were not present in commercial breeds. The results obtained in this study reflect the current genetic status and breeding management of the two Croatian indigenous local breeds. Given the small populations of both breeds, a controlled management activity has been implemented in Black Slavonian pigs since their commercial value has been recognized. In contrast, the extremely high inbreeding level observed in Turopolje pig argues for an urgent conservation plan with a long-term, diversity-oriented breeding program.</p>
DNA methylation profiling and genomic analysis in 20 children with short stature who were born small-for-gestational age
<p><b><span>Purpose:</span></b> In a significant proportion of children born small-for-gestational age (SGA) with failure of catch-up growth, the etiology of short stature remains unclear after routine diagnostic work-up. We wanted to investigate if extensive analysis of the (epi)genome can unravel the cause of growth failure in a significant portion of these children.</p> <p><b><span>Patients and Methods:</span></b><span> Twenty </span><span>SGA</span><span> children treated with growth hormone (GH) because of short stature were selected from the BELGROW database of the Belgian Society for Pediatric Endocrinology and Diabetology </span>for<span> exome sequencing, SNP array and genome-wide methylation analysis to identify the (epi)genetic cause. First year response to GH was compared to the response of SGA patients in the KIGS database.</span></p> <p><b><span>Results:</span></b><span> We identified (likely) pathogenic variants in 4 children (from 3 families) using exome sequencing and found pathogenic CNV in 2 probands using SNP array. In a child harboring a <i>NSD1</i>-containing microduplication, we identified a DNA methylation signature that is opposite to the genome-wide DNA methylation signature of Sotos syndrome. Moreover, we observed multi-locus imprinting disturbances in two children in whom no other genomic alteration could be identified. Five out of 6 children with a genetic diagnosis had an "above average" response to GH.</span></p> <p><b><span>Conclusions: </span></b><span>The study indicates that a more advanced approach with deep genotyping can unravel unexpected (epi)genomic alterations in SGA children with persistent growth failure. Most SGA children with a genetic diagnosis had a good response to GH treatment.</span></p>
Whole genome sequence analysis of porcine astroviruses reveals novel genetically diverse genotypes circulating in East African smallholder pig farms
<p>Supplementary materials for the porcine astrovirus study in East Africa.</p> <p><strong>Table S1</strong>: Pairwise comparison of nucleotide sequence identities of the complete (near complete, U460) genomes of the seven (7) astrovirus field strains (bold) and with sequences of other astroviruses available in GenBank </p> <p><strong>Table S2</strong>. Summary of nucleotide sequence identity matrix of the capsid protein (ORF2) among the seven (7) astroviruses field strains (bold) and the known reference strains in the GenBank using Clustal Omega</p> <p><strong>Table S3</strong>. Summary of amino acid sequence identity matrix of the capsid protein (ORF2) among the 7 astroviruses field strains (bold) and the known reference strains in the GenBank using Clustal Omega</p> <p><strong>Table S4</strong>: Estimates of evolutionary divergence between the East African PoAstVs and selected known AstV in the GenBank based on the amino acid sequences of complete ORF2 protein. The number of amino acid differences per site from between sequences is shown. Standard error estimate(s) are shown above the diagonal for our strains.</p> <p><strong>Table S5</strong>. Recommended potential linear antigenic epitopes predicted inside capsid protein (ORF2) of our field strains by SVMTriP web-based tool and corresponding antigenicity predicted by VaxiJen software</p>
Berbers and Arabs: tracing the genetic diversity and history of Southern Tunisia through genome wide analysis
<p>SNP data of 79 individuals from 3 ethnolinguistic groups from Tunisia</p>
Data from: The first complete mitochondrial genome of the Indian Tent Turtle, Pangshura tentoria (Testudines: Geoemydidae): characterization and comparative analysis
Characterization of complete mitogenome is a widely used genomics study for species delineation and evolutionary research. However, the sequences and structural motifs contained within the mitogenome have been rarely examined to understand the phylogeny and evolutionary history among Testudines. Hence, the mitogenomic features of several Testudines taxa are still anonymous to the scientific communities. The present study decodes the first complete mitochondrial genome of the Indian Tent Turtle, Pangshura tentoria (16,657 bp) by using next-generation sequencing. This denovo assembly encodes 37 genes: 13 protein coding genes (PCGs), 22 transfer RNA (tRNAs), two ribosomal RNA (rRNAs), and one control region (CR). The mitogenome contained 19 intergenic spacer and six overlapping regions. Most of the genes were encoded on majority strand, except for one PCG (NADH dehydrogenase subunit 6) and eight tRNAs. Most of the PCGs were started with an ATG initiation codon, except for cytochrome oxidase subunit 1 with 'GTG' and NADH dehydrogenase subunit 5 with 'ATA'. The termination codons, 'TAA' and 'AGA' were observed in NADH dehydrogenase subunit 4l and NADH dehydrogenase subunit 6 respectively. The Relative Synonymous Codon Usage analysis revealed the maximum abundance of Alanine, Isoleucine, Leucine, and Threonine. The non-synonymous/synonymous ratios were <1 in all PCGs, which indicates strong negative selection among all Geoemydid species. The study also found the typical cloverleaf secondary structure in most of the tRNA genes, except for Serine (trnS1) with lack of the conventional DHU arm. The Wobble base pairing was observed in the different stems (DHU, acceptor, and anticodon) of 11 tRNAs. The comparative study of Geoemydid mitogenomes revealed the occurrence of tandem repeats was frequent in the 3´ end of CR. Further, two copies of a unique tandem repeat 'TTCTCTTT' were identified in P. tentoria. The Bayesian and Maximum Likelihood phylogenetic trees using concatenation of 13 PCGs revealed the close relationships of P. tentoria with Batagur trivittata in the studied dataset. All the Geoemydid species showed distinct clustering with high bootstrap support congruent with previous evolutionary hypotheses. We suggest that the generations of more mitogenomes of Geoemydid species, especially for Batagurinae subfamily, are required to improve our understanding their in-depth phylogenetic and evolutionary relationships.
Analysis of fungal genomes reveals commonalities of intron gain or loss and functions in intron-poor species
<p>Datasets for DOI: <a href="https://doi.org/10.1101/2020.08.11.247098">10.1101/2020.08.11.247098</a>. Jupyter notebooks to reproduce the analysis of this study is available at <a href="https://github.com/Brookesloci/fungi_intron_paper_2020">GitHub</a></p> <ul> <li>annotations.total.txt.gz - gene annotation file of 350 fungi species and outgroups <em>Homo sapiens</em> and <em>Fonticula alba</em></li> <li>site_histories_41490_51_2L_1G.txt.gz - intron site histories of 263 fungi species and outgroups <em>Homo sapiens</em> and <em>Fonticula alba.</em></li> </ul>
FIGURE 8 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 8. Tree showing the phylogenetic relationships among Lepidoptera species, constructed using Maximum Likelihood method. Bootstrap values (1000 repetitions) of the branches are indicated. Drosophila incompta (NC_025936) and Anopheles gambiae (NC_002084) were used as outgroups.
FIGURE 7 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 7. Features present in the A+T-rich region of Smerinthus planus. The ATATG motif is yellow shaded. The poly-T stretch is dotted underlined while the poly-A stretch is underlined. The single microsatellite T/A repeat sequence is indicated by gray shaded.
FIGURE 5 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 5. Putative secondary structures of the 22 tRNA genes of the Smerinthus planus mitochondrial genome.
FIGURE 6 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 6. Sequence alignment of PCG and tRNA regions from 27 different Lepidoptera species. 6A, The color sequence part is motif AAGATAGAAACCAACCTGGCTYACACCGGTTTGAACTCAGATCATGTAAG; 6B, The color sequence part is motif GAAGAATGAACTAAAGCAGAAACWGGAGTWGGAGCWGCTATAGCWGCWGG; 6C, The color sequence part is motif AAYCCWGAAACTAATTCTCTTTCHCCTTCAGCAAAATCAAAAGGAGTWCG.
FIGURE 4. A in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 4. A. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of 31 species in the Lepidoptera. Codon families are plotted on the X axis. B. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of S. planus in the Lepidoptera. Codon families are plotted on the X axis.
FIGURE 2 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 2. Comparison of the codon usage patterns within the mitochondrial genome of different Lepidoptera species.
FIGURE 3 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 3. Codon distribution patterns in various Lepidoptera species. The y-coordinate is the proportion of codons per 100 codons.
FIGURE 1 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 1. Map of the mitogenome of S. planus. The tRNA genes are labeled according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 refer to the cytochrome c oxidase subunits; cob refers to cytochrome b; nad1-nad6 refer to NADH dehydrogenase components; rrnL and rrnS refer to ribosomal RNAs. Gene named above the bar are located on major strand, while the others are located on minor strand.
Data for "Analysis of metagenome-assembled viral genomes from the human gut reveals diverse putative CrAss-like phages with unique genomic features"
<p>Data for "Analysis of metagenome-assembled viral genomes from the human gut reveals diverse putative CrAss-like phages with unique genomic features" (submitted to Nature Communications)</p>
Continental-scale genomic analysis suggests shared post-admixture adaptation in the Americas - Z scores tables
<p><strong>Zscores20Pop. </strong>20pop dataset Z scores by SNP in the three ancestries (A. Africa B. Europe C. America).</p> <p><strong>Zscores1090Ind.</strong> 1090Ind dataset Z scores by SNP in the three ancestries (A. Africa B. Europe C. America).</p>
Phyton scripts to generate Figure 9.1: Rarefaction curves of twenty biggest genera (i.e., having the most number of available genomes) from the global analysis of 1.2 million BGCs.
<p>Phyton scripts to generate Figure 9.1: Rarefaction curves of twenty biggest genera (i.e., having the most number of available genomes) from the global analysis of 1.2 million BGCs.</p>
Population genomics and haplotype analysis in spelt and bread wheat identifies a gene regulating glume color
<p>The cloning of agriculturally important genes is often complicated by haplotype variation across crop cultivars. Access to pan-genome information greatly facilitates the assessment of structural variations and rapid candidate gene identification. Here, we identified the <i>red glume 1</i> (<i>Rg-B1</i>) gene using association genetics and haplotype analyses in ten reference-grade wheat genomes. Glume color is an important trait to characterize wheat cultivars. Red glumes are frequent among Central European spelt, a dominant wheat subspecies in Europe before the 20<sup>th</sup> century. We used genotyping-by-sequencing to characterize a global diversity panel of 267 spelt accessions, which provided evidence for two independent introductions of spelt into Europe. A single region at the <i>Rg-B1</i> locus on chromosome 1BS was associated with glume color in the diversity panel. Haplotype comparisons across ten high-quality wheat genomes revealed a <i>MYB</i> transcription factor as candidate gene. We found extensive haplotype variation across the ten cultivars, with a particular group of <i>MYB</i> alleles that was conserved in red glume wheat cultivars. Genetic mapping and transient infiltration experiments allowed us to validate this particular <i>MYB</i> transcription factor variants. Our study demonstrates the value of multiple high-quality genomes to rapidly resolve copy number and haplotype variations in regions controlling agriculturally important traits.</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.