Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
12,393
datasets available to search
ShareScore release 0.9.0
Dataset results
12,393 results for “materiality”
Supplementary material 3 from: Lee G-E, Han T, Jeong J, Kim S-H, Park IG, Park H (2015) Molecular phylogeny of the genus Dicronocephalus (Coleoptera, Scarabaeidae, Cetoniinae) based on mtCOI and 16S rRNA genes. ZooKeys 501: 63-87. https://doi.org/10.3897/zookeys.501.8658
The combined dataset of COI and 16S rRNA of Dicronocephalus species in this study.: Explanation note: There is the concatenated sequences of COI and 16S rRNA genes correspondence with each sample.
Supplementary material 2 from: Schindler S, Staska B, Adam M, Rabitsch W, Essl F (2015) Alien species and public health impacts in Europe: a literature review. NeoBiota 27: 1-23. https://doi.org/10.3897/neobiota.27.5007
Alien species studied in the 56 original articles.: Explanation note: Alien species studied in the 56 original articles, their regions of origin (continents) and their introduction pathways.
Supplementary material 2 from: Lee G-E, Han T, Jeong J, Kim S-H, Park IG, Park H (2015) Molecular phylogeny of the genus Dicronocephalus (Coleoptera, Scarabaeidae, Cetoniinae) based on mtCOI and 16S rRNA genes. ZooKeys 501: 63-87. https://doi.org/10.3897/zookeys.501.8658
16S rRNA sequences data set of Dicronocephalus species in this study.: Explanation note: This 16S rRNA data includes 46 individual sequences of the examined Dicronocephalus species in this study.
Supplementary material 1 from: Kuebbing SE, Simberloff D (2015) Missing the bandwagon: Nonnative species impacts still concern managers. NeoBiota 25: 73-86. https://doi.org/10.3897/neobiota.25.8921
TNC Non-native Species Management Survey: Explanation note: Online survey to assess land managers nonnative species management strategies.
Supplementary material 1 from: Ullmann J, Stachowitsch M (2015) A critical review of the Mediterranean sea turtle rescue network: a web looking for a weaver. Nature Conservation 10: 45-69. https://doi.org/10.3897/natureconservation.10.4890
Stepping stones toward a Mediterranean sea turtle rescue network: Explanation note: Historical outline of sea turtle protection in the Mediterranean.
Supplementary material 1 from: Mesibov R (2015) Three new species of Tasmaniosoma Verhoeff, 1936 (Diplopoda, Polydesmida, Dalodesmidae) from northeast Tasmania, Australia. ZooKeys 488: 31-46. https://doi.org/10.3897/zookeys.488.9460
Specimen records of Tasmaniosoma species.: Explanation note: Specimen records of Tasmaniosoma species as of 15 February 2015.
Supplementary material 1 from: Aguirre H, de Almeida LP, Shaw SR, Sarmiento CE (2015) An illustrated key to Neotropical species of the genus Meteorus Haliday (Hymenoptera, Braconidae, Euphorinae). ZooKeys 489: 33-94. https://doi.org/10.3897/zookeys.489.9258
Revised material: Explanation note: Data set containing information about parasitoid species, host species, distribution, trapping method and depository.
Supplementary material 7 from: Tedersoo L, Anslan S, Bahram M, Põlme S, Riit T, Liiv I, Kõljalg U, Kisand V, Nilsson RH, Hildebrand F, Bork P, Abarenkov K (2015) Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys 10: 1-43. https://doi.org/10.3897/mycokeys.10.4852
Table S7. Taxonomic classification of the rDNA of fungal.: Explanation note: Taxonomic classification of the rDNA of fungal shotgun metagenome.
Supplementary material 1 from: Kilgallen NM, Lowry JK (2015) A review of the scopelocheirid amphipods (Crustacea, Amphipoda, Lysianassoidea), with the description of new taxa from Australian waters. Zoosystematics and Evolution 91(1): 1-43. https://doi.org/10.3897/zse.91.8440
Collection data for new species of Scopelocheiridae described: Explanation note: Collection data and registration information for new taxa described in this paper.
Supplementary material 1 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 1: Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.
Supplementary material 3 from: Tedersoo L, Anslan S, Bahram M, Põlme S, Riit T, Liiv I, Kõljalg U, Kisand V, Nilsson RH, Hildebrand F, Bork P, Abarenkov K (2015) Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys 10: 1-43. https://doi.org/10.3897/mycokeys.10.4852
Table S3. Data set of the SSU V4 and V5 barcodes.: Explanation note: Data set of the SSU V4 and V5 barcodes.
Supplementary material 1 from: Tedersoo L, Anslan S, Bahram M, Põlme S, Riit T, Liiv I, Kõljalg U, Kisand V, Nilsson RH, Hildebrand F, Bork P, Abarenkov K (2015) Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys 10: 1-43. https://doi.org/10.3897/mycokeys.10.4852
Table S1. Characteristics of soil samples.: Explanation note: Characteristics of soil samples used in this study.
Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.
Supplementary material 6 from: Tedersoo L, Anslan S, Bahram M, Põlme S, Riit T, Liiv I, Kõljalg U, Kisand V, Nilsson RH, Hildebrand F, Bork P, Abarenkov K (2015) Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. MycoKeys 10: 1-43. https://doi.org/10.3897/mycokeys.10.4852
Table S6. Data set of the LSU D1, D2, and D3 barcodes.: Explanation note: Data set of the LSU D1, D2, and D3 barcodes.
Supplementary material 1 from: Knight L, Brancelj A, Hänfling B, Cheney C (2015) The groundwater invertebrate fauna of the Channel Islands. Subterranean Biology 15: 69-94. https://doi.org/10.3897/subtbiol.15.4792
Table 2: Invertebrate taxa recorded from wells and boreholes on Jersey: Explanation note: List of taxa recorded on Jersey.
Supplementary material 2 from: Wayland MT, Vainio JK, Gibson DI, Herniou EA, Littlewood TDJ, Väinölä R (2015) The systematics of Echinorhynchus Zoega in Müller, 1776 (Acanthocephala, Echinorhynchidae) elucidated by nuclear and mitochondrial sequence data from eight European taxa. ZooKeys 484: 25-52. https://doi.org/10.3897/zookeys.484.9132
Maximum likelihood model parameters: Explanation note: Model parameters used in the maximum likelihood approach to phylogenetic reconstruction.
Supplementary material 3 from: Runyon JB, Hurley RL (2015) A revision of the Nearctic species of Liancalus Loew (Diptera, Dolichopodidae). ZooKeys 483: 97-147. https://doi.org/10.3897/zookeys.483.9222
Supplemental Video 3: Explanation note: Two males of Liancalus similis showing the typical looping flight of Liancalus adults. This video was taken looking upwards on vertical basalt column on Palisade Falls, Gallatin County, Montana on October 12, 2012.
Supplementary material 1 from: Hansson C, Smith MA, Janzen DH, Hallwachs W (2015) Integrative taxonomy of New World Euplectrus Westwood (Hymenoptera, Eulophidae), with focus on 55 new species from Area de Conservación Guanacaste, northwestern Costa Rica. ZooKeys 485: 1-236. https://doi.org/10.3897/zookeys.485.9124
Neighbour Joining (NJ) tree for all specimens of the DNA barcoded Euplectrus: Explanation note: This NJ tree includes all Euplectrus specimens with a barcode and supplements the NJ tree (Fig. 35) that includes only one representative barcode per species.
Supplementary material 2 from: Runyon JB, Hurley RL (2015) A revision of the Nearctic species of Liancalus Loew (Diptera, Dolichopodidae). ZooKeys 483: 97-147. https://doi.org/10.3897/zookeys.483.9222
Supplemental Video 2: Explanation note: Two adult males of Liancalus similis on Palisade Falls, Gallatin County, Montana on October 12, 2012. This video was taken looking upwards on vertical basalt column near water of falls.
Supplementary material 4 from: Wayland MT, Vainio JK, Gibson DI, Herniou EA, Littlewood TDJ, Väinölä R (2015) The systematics of Echinorhynchus Zoega in Müller, 1776 (Acanthocephala, Echinorhynchidae) elucidated by nuclear and mitochondrial sequence data from eight European taxa. ZooKeys 484: 25-52. https://doi.org/10.3897/zookeys.484.9132
Patterns of COI sequence variation: Explanation note: Patterns of COI sequence variation. Graphs and discussion of patterns of nucleotide substitions in the COI data-set.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.