Find research datasets worth reusing

Fig. 8 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 8. Dorsal views of skulls of Miniopterus spp. from Madagascar: (above, from left to right) M. manavi (FMNH 194074) from the Grotte de Fandanana, near Fandriana; M. griveaudi (FMNH 169712) from near the Andrafiabe Cave, Ankarana; holotype of M. aelleni (FMNH 173067), from the Canyon d'Antsiroandoa, Ankarana; below, left) holotype of M. brachytragos (FMNH 175840), from the Forêt d'Ambovonomby, Parc National de Namoroka; and (below, right) holotype of M. mahafaliensis (FMNH 173197), from near Mitoho Cave, Parc National de Tsimanampetsotsa. (Photograph taken by J. Weinstein, Field Museum image number Z94488_01d.)

Fig. 7 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 7. Different views of skull and mandible of the holotype of Miniopterus mahafaliensis (FMNH 173197) collected in the Parc National de Tsimanampetsotsa, 6.5 km NE Efoetse, near Mitoho Cave: (above, left) dorsal view of cranium; (above, right) ventral view of cranium; and (below) lateral view of cranium and mandible. (Photograph taken by John Weinstein, Field Museum image number Z94487_05d.)

Fig. 6 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 6. Photograph of living Miniopterus mahafaliensis captured 6.5 km NE Efoetse, near Mitoho Cave, Parc National de Tsimanampetsotsa (FMNH 173191), taken at the same locality as the holotype (FMNH 173197). Note the gray grizzled hair to the ventrum. (Photograph by Harald Schütz.)

Fig. 5 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 5. Different views of skull and mandible of the holotype of Miniopterus brachytragos (FMNH 175840) collected in the Parc National de Namoroka, Forêt d'Ambovonomby, 26 km NW Andranomavo: (above, left) dorsal view of cranium; (above, right) ventral view of cranium; and (below) lateral view of cranium and mandible. (Photograph taken by John Weinstein, Field Museum image number Z94486_05d.)

Fig. 9 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 9. Ventral views of skulls of Miniopterus spp. from Madagascar: (above, from left to right) M. manavi (FMNH 194074) from the Grotte de Fandanana, near Fandriana; M. griveaudi (FMNH 169712) from near the Andrafiabe Cave, Ankarana; holotype of M. aelleni (FMNH 173067), from the Canyon d'Antsiroandoa, Ankarana; (below, left) holotype of M. brachytragos (FMNH 175840), from the Forêt d'Ambovonomby, Parc National de Namoroka, Forêt d'Ambovonomby; and (below, right) holotype of M. mahafaliensis (FMNH 173197), from near Mitoho Cave, Parc National de Tsimanampetsotsa. (Photograph taken by J. Weinstein, Field Museum image number Z94488_02d.)

Fig. 4 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 4. Right ear and tragus of Miniopterus spp. from Madagascar: A, M. brachytragos (FMNH 175840, holotype), from Parc National de Namoroka, Forêt d'Ambovonomby, 26 km NW Andranomavo; B, M. brachytragos (FMNH 172685) from the Forêt de Binara, near Analamazava River, 7.5 km SW Daraina (village); C, M. brachytragos (FMNH 202523) from 1.8 km S Ambanizana, Masoala Peninsula; D, M. mahafaliensis (FMNH 173197, holotype) from Parc National de Tsimanampetsotsa, 6.5 km NE Efoetse, near Mitoho Cave; E, M. mahafaliensis (FMNH 176101) from Parc National de Kirindy-Mite, near village of Betakilotra, 11 km SE Marofihitsa; F, M. griveaudi (FMNH 184055) from Beloboka, grotte n°1, 12.5 km E Mahajanga, Madagascar; G, M. aelleni (FMNH 175842) from the Parc National de Namoroka, Forêt d'Ambovonomby, 26 km NW Andranomavo. The slightly elongated and pointed distal portion of the tragus in FMNH 175840 (A), as compared to FMNH 172685 and FMNH 202523, maybe an anomalous shape in M. brachytragos.

Fig. 1 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 1. Map of Madagascar showing localities mentioned in the text and sites where specimens of Miniopterus brachytragos sp. nov., M. mahafaliensis sp. nov., M. manavi sensu stricto, M. petersoni, M. griveaudi, and M. aelleni have been collected. The latter two species are also known from the Comoro Archipelago (Goodman et al., 2009b). The species symbols for the sites of Namoroka and Bemaraha have been slightly spread out to avoid obscuring information.

Fig. 2 in The Use of Molecular Phylogenetic and Morphological Tools to Identify Cryptic and Paraphyletic Species: Examples from the Diminutive Long-fingered Bats (Chiroptera: Miniopteridae: Miniopterus) on Madagascar

Fig. 2. Phylogenetic position of different Miniopterus spp. Miniopterus fuliginosus was selected as the outgroup. The tree presented was produced using Bayesian analysis. Posterior probabilities (Bayesian

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

Fig. 53 in Freshwater Stingrays Of The Green River Formation Of Wyoming (Early Eocene), With The Description Of A New Genus And Species And An Analysis Of Its Phylogenetic Relationships (Chondrichthyes: Myliobatiformes)

Fig. 53. Strict consensus tree (length = 57 steps, CI = 0.63, RI = 0.69) of 12 equally most parsimonious trees (length = 53 steps, CI = 0.65, RI = 0.72) obtained with phylogenetic analysis performed with matrix in table 7 (with pelagic stingrays experimentally coded as a single terminal, Myliobatidae). See appendix 2 for further details.

Fig. 51 in Freshwater Stingrays Of The Green River Formation Of Wyoming (Early Eocene), With The Description Of A New Genus And Species And An Analysis Of Its Phylogenetic Relationships (Chondrichthyes: Myliobatiformes)

Fig. 51. Tree resulting from our phylogenetic analysis of myliobatiforms, showing placement of two early Eocene stingray taxa from the Monte Bolca Formation of northeastern Italy (fossils presented in fig. 49). These taxa allow for the timing of divergence events between the node that gives rise to †Heliobatis and the node that contains gymnurids and myliobatids; the groups derived directly from the main stem of the phylogeny between these nodes must have originated at least by the early Eocene (roughly 50 mya). See figure 48 for geographical distribution of terminal taxa.

Fig. 52 in Freshwater Stingrays Of The Green River Formation Of Wyoming (Early Eocene), With The Description Of A New Genus And Species And An Analysis Of Its Phylogenetic Relationships (Chondrichthyes: Myliobatiformes)

Fig. 52. Maps showing the distribution of the continents and the extent of their coastlines (in darker line) from Late Cretaceous (Maastrichtian) to middle Eocene, spanning some 25 million years (modified from Smith et al., 1994). Arrowheads indicate the extent of marine incursions (epicontinental seaways) into South America from the north (the protoCaribbean/eastern Pacific region) during these intervals. Mya = million years ago.

Fig. 49 in Freshwater Stingrays Of The Green River Formation Of Wyoming (Early Eocene), With The Description Of A New Genus And Species And An Analysis Of Its Phylogenetic Relationships (Chondrichthyes: Myliobatiformes)

Fig. 49. Fossil stingrays from the marine early Eocene Monte Bolca deposits of northeastern Italy. A. †Promyliobatis gazolae (MCSNV VII B 90), a myliobatid. B. †''Dasyatis'' muricata (MCSNV VII B 92), a whiptailed stingray. The phylogenetic positions of both taxa are shown in figure 51.

Fig. 46 in Freshwater Stingrays Of The Green River Formation Of Wyoming (Early Eocene), With The Description Of A New Genus And Species And An Analysis Of Its Phylogenetic Relationships (Chondrichthyes: Myliobatiformes)

Fig. 46. Previous morphological phylogenies of stingrays (Myliobatiformes). A. Nishida (1990). B. Lovejoy (1996) and McEachran et al. (1996). Nishida's analysis contained many species, and what is shown is only a summary of his scheme (e.g., Trygonoptera was shown nested within Urolophus). The trees of Lovejoy and McEachran et al. originally differed in relation to the taxa included (see text) but are summarized here identically for simplicity without altering the pattern of relationships that they obtained.

Fig. 45 in Freshwater Stingrays Of The Green River Formation Of Wyoming (Early Eocene), With The Description Of A New Genus And Species And An Analysis Of Its Phylogenetic Relationships (Chondrichthyes: Myliobatiformes)

Fig. 45. Five subgroups of trees showing the different phylogenetic positions of †Asterotrygon that result once uncertainty concerning the relationships among dasyatid genera is eliminated from the minimumlength trees obtained in this study (based on matrix in table 5; strict consensus in fig. 43). †Asterotrygon pairs with urolophids in the subgroups depicted in C–E, representing 21 of the 35 equally most parsimonious trees (see text for details).

Fig. 44. Tree topology taken from figure 43 in Freshwater Stingrays Of The Green River Formation Of Wyoming (Early Eocene), With The Description Of A New Genus And Species And An Analysis Of Its Phylogenetic Relationships (Chondrichthyes: Myliobatiformes)

Fig. 44. Tree topology taken from figure 43 (strict consensus tree) with ambiguous characters mapped (numbered as in text and matrix in table 5, unambiguous characters in fig. 43). Some of the characters are ambiguous because they are scored as uncertain in Hexatrygon (characters 4 and 21) and in Myliobatis (character 16); these are displayed conservatively on the tree (i.e., it is not simply assumed that they will be found in these taxa). Other characters have more than one equally parsimonious optimization (characters 3, 20, 32, 43), whereas others are scored as uncertain in the Green River stingrays (characters 12, 22, and 44). The optimization chosen in both of these cases is accelerated transformation, favoring reversals over independent gains. Characters denoted with an asterisk (*) are part of multistate transformation series that have unambiguous character states in figure 43.