Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
10,163
datasets available to search
ShareScore release 0.9.0
Dataset results
10,163 results for “Gen”
FIGURES 1–12 in Sertania gen. nov., a new genus of butterflies (Lepidoptera: Riodinidae) from the South American dry diagonal
FIGURES 1–12. Sertania gen. nov. species in dorsal and ventral views, respectively. 1–4, Sertania guttata comb. nov., male (DNA-voucher BLU882) (1–2) from Capilla del Monte, Cordoba, Argentina (ZUEC), and female (3–4) from La Rioja, Argentina (MACN); 5–8, Sertania jaibensis comb. nov., stat. nov., male holotype (5–6) from Jaíba, Minas Gerais, Brazil (MNRJ), and female (DNA-voucher NS0104) (7–8) from Sempre Vivas National Park, Buenópolis, Minas Gerais, Brazil (ZUEC); 9–12, Sertania lambedor comb. nov., stat. nov., male (DNA-voucher BLU889) (9–10) from Custódia, Pernambuco, Brazil (ZUEC), and female (11–12) from Catimbau National Park, Pernambuco, Brazil (Cemafauna-Univasf). Scale bar = 1 cm.
FIGURE 10 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 10. Paraceto spiralis sp. n., A. male left palp, prolateral view; B. same, ventral view; C. same, retrolateral view; D. epigyne, ventral view; E. vulva, dorsal view; F. schematic of internal duct system.
FIGURE 6 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 6. Paraceto spirallus sp. n., A. male habitus, dorsal view; B. same, ventral view; C. female habitus, dorsal view; D. same, ventral view.
FIGURE 7 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 7. Paraceto spiralis sp. n., A. male habitus, lateral view; B. female habitus, lateral view; C. male cephalothorax, frontal view; D. female cephalothorax, frontal view; E. same, frontal-ventral view; F. male ocular area, dorsal view; G. female ocular area, dorsal view.
FIGURE 3 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 3. Cetonana laticeps (Canestrini, 1868), A. male left palp, prolateral view; B. same, ventral view; C. same, retrolateral view; D. same, dorsal view; E. epigyne, ventral view; F. vulva, dorsal view.
FIGURE 2 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 2. Cetonana laticeps (Canestrini, 1868), female, A. habitus, dorsal view; B. same, ventral view; C. ocular area, dorsal view; D. cephalothorax, frontal view; E. same, frontal-ventral view; F. left tibia, metatarsus and tarsus I, ventral view; G. left tibia, metatarsus and tarsus II, ventral view; H. left metatarsus and tarsus III, prolateral view; I. left metatarsus and tarsus IV, prolateral view; J. habitus, lateral view.
FIGURE 5 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 5. Cetonana shaanxiensis sp. n., A. epigyne, ventral view; B. vulva, dorsal view; C. epigyne, ventral view; D. vulva, dorsal view; E. schematic of internal duct system.
FIGURE 1 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 1. Cetonana laticeps (Canestrini, 1868), male, A. habitus, dorsal view; B. same, ventral view; C. ocular area, dorsal view; D. cephalothorax, frontal view; E. same, frontal-ventral view; F. right tibia, metatarsus and tarsus I, ventral view; G. right tibia, metatarsus and tarsus II, ventral view; H. left metatarsus and tarsus III, prolateral view; I. left metatarsus and tarsus IV, prolateral view; J. habitus, lateral view.
FIGURE 9 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 9. Paraceto spiralis sp. n., A. male left palp, prolateral view; B. same, ventral view; C. same, retrolateral view; D. same, dorsal view; E. male left palpal femur, ventral view; F. epigyne, ventral view; G. vulva, dorsal view.
FIGURE 11 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 11. Paraceto orientalis (Schenkel, 1936) comb. n., female, A. habitus, dorsal view; B. same, ventral view; C. ocular area, dorsal view; D. cephalothorax, frontal view; E. right legs I and II, retrolateral view; F. habitus, lateral view; G. epigyne, ventral view; H. vulva, dorsal view.
FIGURE 8 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 8. Paraceto spiralis sp. n., A. male left leg I, retrolateral view; B. male left leg II, retrolateral view; C. male left metatarsus and tarsus I, ventral view; D. male left metatarsus and tarsus II, ventral view; E. male left leg III, retrolateral view; F. male left leg IV, retrolateral view; G. female left metatarsus and tarsus I, retrolateral view; H. female left leg III, retrolateral view; I. female left leg IV, retrolateral view.
FIGURE 4 in Description of Paraceto gen. n. and a relimitation of the genus Cetonana (Araneae: Trachelidae)
FIGURE 4. Cetonana shaanxiensis sp. n., female, A. habitus, dorsal view; B. same, ventral view; C. ocular area, dorsal view; D. cephalothorax, frontal view; E. habitus, lateral view; F. left tibia, metatarsus and tarsus I, ventral view; G. left tibia, metatarsus and tarsus II, ventral view.
Supplementary material 5 from: Moreira GRP, Eltz RP, Pase RB, Silva GT, Bordignon SAL, Mey W, Gonçalves GL (2017) Cecidonius pampeanus, gen. et sp. n.: an overlooked and rare, new gall-inducing micromoth associated with Schinus in southern Brazil (Lepidoptera, Cecidosidae). ZooKeys 695: 37-74. https://doi.org/10.3897/zookeys.695.13320
Figure S2. : Explanation note: Neighbor-Joining tree of Cecidonius pampeanus with the evolutionary distances computed using the Kimura 2-parameter method based on 1.6 Kb of cytochrome oxidase sequences. The analysis involved 60 individuals from 10 populations.
Supplementary material 4 from: Moreira GRP, Eltz RP, Pase RB, Silva GT, Bordignon SAL, Mey W, Gonçalves GL (2017) Cecidonius pampeanus, gen. et sp. n.: an overlooked and rare, new gall-inducing micromoth associated with Schinus in southern Brazil (Lepidoptera, Cecidosidae). ZooKeys 695: 37-74. https://doi.org/10.3897/zookeys.695.13320
Figure S1. : Explanation note: Graphs depicting the results of the mismatch distribution analysis for the total samples (C. pampeanus) and populations alone (P6 to P9). The analysis was performed with 1420 bp of COI sequences (excluding all sites with missing information or gaps).
Supplementary material 3 from: Moreira GRP, Eltz RP, Pase RB, Silva GT, Bordignon SAL, Mey W, Gonçalves GL (2017) Cecidonius pampeanus, gen. et sp. n.: an overlooked and rare, new gall-inducing micromoth associated with Schinus in southern Brazil (Lepidoptera, Cecidosidae). ZooKeys 695: 37-74. https://doi.org/10.3897/zookeys.695.13320
Table S3. : Explanation note: Specimens used in this study for phylogenetic reconstruction and genetic structure analysis of C. pampeanus.
Supplementary material 1 from: Moreira GRP, Eltz RP, Pase RB, Silva GT, Bordignon SAL, Mey W, Gonçalves GL (2017) Cecidonius pampeanus, gen. et sp. n.: an overlooked and rare, new gall-inducing micromoth associated with Schinus in southern Brazil (Lepidoptera, Cecidosidae). ZooKeys 695: 37-74. https://doi.org/10.3897/zookeys.695.13320
Table S1. : Explanation note: Primers and conditions used in polymerase chain reaction (PCR) to amplify COI, 16S and Wg genes.
Supplementary material 2 from: Moreira GRP, Eltz RP, Pase RB, Silva GT, Bordignon SAL, Mey W, Gonçalves GL (2017) Cecidonius pampeanus, gen. et sp. n.: an overlooked and rare, new gall-inducing micromoth associated with Schinus in southern Brazil (Lepidoptera, Cecidosidae). ZooKeys 695: 37-74. https://doi.org/10.3897/zookeys.695.13320
Table S2. : Explanation note: Analysis of Molecular Variance (AMOVA) using φ-statistics based on cytochrome oxidase subunit I mitochondrial sequences for groups of C. pampeanus, defined according to different dispersal barriers.
Supplementary material 1 from: Huemer P, Lopez-Vaamonde C, Triberti P (2016) A new genus and species of leaf-mining moth from the French Alps, Mercantouria neli gen. n., sp. n. (Lepidoptera, Gracillariidae). ZooKeys 586: 145-162. https://doi.org/10.3897/zookeys.586.8375
Sample information for specimens used in this study : Explanation note: Details of collecting data, images, sequences, and trace files for the barcoded specimens are available in the public BOLD dataset "DS-CAYOLLE", accessed at https://doi.org/10.5883/DS-CAYOLLE
Supplementary material 1 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 1: Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.
Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.