Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
1,646
datasets available to search
ShareScore release 0.9.0
Dataset results
1,646 results for “plot”
Data, scripts, and plots for the paper "A Comparative Study of OpenMP Scheduling Algorithm Selection Strategies"
<p>Data, scripts, and plots for the paper "A Comparative Study of OpenMP Scheduling Algorithm Selection Strategies"</p>
-0.2 0.0 0.2 0.4 0.6 PC1 (29.8% of total variance) Fig. 8. Morphospace plot of the first two PCO axes generated in the R statistical environment (Claddis package). Branches are superimposed from a single representative topology selected from amongst the 48 MPTs. in The sauropodomorph biostratigraphy of the Elliot Formation of southern Africa: Tracking the evolution of Sauropodomorpha across the Triassic-Jurassic boundary
-0.2 0.0 0.2 0.4 0.6 PC1 (29.8% of total variance) Fig. 8. Morphospace plot of the first two PCO axes generated in the R statistical environment (Claddis package). Branches are superimposed from a single representative topology selected from amongst the 48 MPTs.
Fig. 3. NMDS plot for the parasite infracommunity composition recovered from 52 in Spillover and spillback risks of ectoparasites by an invasive squirrel Callosciurus erythraeus in Kanto region of Japan
Fig. 3. NMDS plot for the parasite infracommunity composition recovered from 52 host individuals. The influence of each parasite's abundance by discriminating the developmental stage on the score components of the two axes is represented by broken lines. The relationships with environmental variables are indicated by gray arrows. Abbreviations are as follows: M: male, F: female, YH: Yokohama, YS: Yokosuka, HfN: nymph of Haemaphysalis flava, HfL: larva of H. flava, Lep: larva of Leptotrombidium spp., EkA: adult of Enderleinellus kumadai, EkL: larva of E. kumadai, NoA: adult of Neohaematopinus callosciuri, NoL: larva of N. callosciuri, Ca: Ceratophyllus anisus, Ci: Ceratophyllus indages indages.
Surveyed forest plots in Nagano and Gifu prefecture, Japan, using a terrestrial laser scanner
<p>The data was collected using a Leica RTC360 TLS and includes a total of 20 forest plots from different locations in the prefectures Nagano and Gifu, Japan. </p> <p>The data also contains a folder "Quercus_Serrata_Positions" including subfolders for each plot. Inside these folders are .txt files containing all positions of Quercus serrata trees inside the respective forest plot visible in the point cloud data.</p>
The Longyearbyen all-sky camera full resolution image data (movie and four ASC data plots) used in the paper entitled "Auroral Morphological Changes to the Formation of Auroral Spiral during the Late Substorm Recovery Phase: Polar UVI and Ground All-Sky Camera Observations"
<p>The uploaded movie is an animation of the Longyearbyen all-sky camera (ASC) full resolution image data from 20:00 UT to 22:00 UT, which is including all ASC snapshots used in Figure 2. This movie file is the same as Movie S1. </p> <p>The uploaded four png files are the Longyearbyen all-sky camera (ASC) full resolution image snapshots, which were used in Figure S3.</p> <p>The numerical ASCII data to make the four ASC full resolution image snapshots are also uploaded; the count number of data detected by the ASC and associated latitude and longitude information in geographical coordinates of the ASC field of view.</p>
Electrochemical data plotted in A. Fasano, C. Guendon, A. Jacq-Bailly, A. Kpebe, J. Wozniak, C. Baffert, M. del Barrio, V. Fourmond, M. Brugna, C. Léger , « A chimeric NiFe hydrogenase heterodimer to assess the role of the electron transfer chain in tuning the enzyme's catalytic bias and oxygen tolerance », J. Am. Chem. Soc. 145, 36, 20021–20030 (2023). doi: 10.1021/jacs.3c06895
<p>Text file of all the electrochemical data shown in the following paper: A. Fasano, C. Guendon, A. Jacq-Bailly, A. Kpebe, J. Wozniak, C. Baffert, M. del Barrio, V. Fourmond, M. Brugna, C. Léger , « A chimeric NiFe hydrogenase heterodimer to assess the role of the electron transfer chain in tuning the enzyme's catalytic bias and oxygen tolerance », J. Am. Chem. Soc. 145, 36, 20021–20030 (2023). <a href="dx.doi.org/10.1021/jacs.3c06895" target="_blank" rel="noopener">doi: 10.1021/jacs.3c06895</a></p>
Data and analysis and plotting scripts for Swaminathan et al., "Regional Impacts Poorly Constrained by Climate Sensitivity"
<p>The datasets included here are of the plotted data from the figures of the paper entitled "Regional Impacts Poorly Constrained by Climate Sensitivity", by Ranjini Swaminathan, Jacob Schewe, Jeremy Walton, Klaus Zimmermann, Colin Jones, Richard A. Betts, Chantelle Burton, Chris D. Jones, Matthias Mengel, Christopher Reyer, Andrew G. Turner & Katja Weigel, submitted for publication in Earth's Futures. Scripts used for plotting and analysis are also included.</p>
uncropped western blots for analysis of RPN13 ubiquitylation and NRF1 activation by protein aggregates, as well as source data for qPCR plots and flow cytometry gating and FCS files for agDD-GFP in HeLa or HEK cells
<p>This entry contains uncropped blots for Fig 4D and Fig S4C, Fig. 5B, Fig S5 and Fig S6, and the raw FCS files for Flow Cytometry data in doi.org/10.1101/2024.08.30.610524.</p>
Raw plot data for: Accelerating equilibrium isotope effect calculations. II. Stochastic implementation of direct estimators
<p>Data for publication: K. Karandashev, J. Vanicek, Accelerating equilibrium isotope effect calculations. II. Stochastic implementation of direct estimators, J. Chem. Phys. <strong>151</strong>, 134116 (2019) <a href="https://doi.org/10.1063/1.5124995">https://doi.org/10.1063/1.5124995</a></p> <p>This data set contains the raw numerical data for reproducing Figures 1-8 in the publication.</p>
Fig. 2. Principal Component Analysis plot showing the 42 in Evidence of genetic connectivity between fragmented pig populations in a tropical urban city-state
Fig. 2. Principal Component Analysis plot showing the 42 individuals from the Central Catchment Nature Reserve (CCNR) and the Northeast differentiated by sex and age class. Individuals exhibiting genetic admixture are labelled. Percentage variation accounted for by each principal component is indicated in brackets.
Fig. S1. Principal Component Analysis plot showing 28 in Evidence of genetic connectivity between fragmented pig populations in a tropical urban city-state
Fig. S1. Principal Component Analysis plot showing 28 out of 42 individuals from the Central Catchment Nature Reserve (CCNR) and the Northeast with kinship values <0.2. Individuals are differentiated by sex and age class. Individuals exhibiting genetic admixture are labelled. Percentage variation accounted for by each principal component is indicated in brackets.
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Text-fig. 5. Macroevolutionary trends related to the IC model in the first three teeth of the six families of extinct sloths, as well as specimens of the "basal Megatherioidea", Pseudoglyptodon, and Bradypus. Dashed line (- -) shows the regression including all data; solid line shows the regression after the exclusion of Octodontotherium (shown in the plot as a filled triangle). in Unexpected Inhibitory Cascade In The Molariforms Of Sloths (Folivora, Xenarthra): A Case Study In Xenarthrans Honouring Gerhard Storch'S Open-Mindedness
Text-fig. 5. Macroevolutionary trends related to the IC model in the first three teeth of the six families of extinct sloths, as well as specimens of the "basal Megatherioidea", Pseudoglyptodon, and Bradypus. Dashed line (- -) shows the regression including all data; solid line shows the regression after the exclusion of Octodontotherium (shown in the plot as a filled triangle).
Text-fig. 4. Macroevolutionary trends related to the IC model in the last three teeth of the six families of extinct sloths, as well as specimens of the "basal Megatherioidea", Pseudoglyptodon, and Bradypus. Dash-dot line (-.-) shows the regression including all data; solid line shows the regression after the exclusion of Octodontotherium (shown in the plot as a filled triangle). in Unexpected Inhibitory Cascade In The Molariforms Of Sloths (Folivora, Xenarthra): A Case Study In Xenarthrans Honouring Gerhard Storch'S Open-Mindedness
Text-fig. 4. Macroevolutionary trends related to the IC model in the last three teeth of the six families of extinct sloths, as well as specimens of the "basal Megatherioidea", Pseudoglyptodon, and Bradypus. Dash-dot line (-.-) shows the regression including all data; solid line shows the regression after the exclusion of Octodontotherium (shown in the plot as a filled triangle).
Text-fig. 7. Plot of discriminant scores (R1/R2) of individual M1 of Apodemus spp. from particular Pleistocene biozones superimposed onto a plot of variation ranges for the respective variables for the Recent Apodemus sample (based on the discrimination analysis of total set of characters, both metric and non-metric). in Genus Apodemus In The Pleistocene Of Central Europe: When Did The Extant Taxa Appear?
Text-fig. 7. Plot of discriminant scores (R1/R2) of individual M1 of Apodemus spp. from particular Pleistocene biozones superimposed onto a plot of variation ranges for the respective variables for the Recent Apodemus sample (based on the discrimination analysis of total set of characters, both metric and non-metric).
Text-fig. 8. Plot of discriminant scores (R1/R2) of individual m1 of Apodemus spp. from particular Pleistocene biozones superimposed onto a plot of variation ranges for the respective variables for the Recent Apodemus sample (standardized discrimination scores based on nine most significant variables). in Genus Apodemus In The Pleistocene Of Central Europe: When Did The Extant Taxa Appear?
Text-fig. 8. Plot of discriminant scores (R1/R2) of individual m1 of Apodemus spp. from particular Pleistocene biozones superimposed onto a plot of variation ranges for the respective variables for the Recent Apodemus sample (standardized discrimination scores based on nine most significant variables).
Text-fig. 6. Plot of discriminant scores (R1/R2) of individual m1 and M1 teeth of Apodemus spp. from particular Pleistocene biozones superimposed onto a plot of variation ranges for the respective variables for the Recent Apodemus sample (based on the discrimination analysis of metric variables of M1 and m1). in Genus Apodemus In The Pleistocene Of Central Europe: When Did The Extant Taxa Appear?
Text-fig. 6. Plot of discriminant scores (R1/R2) of individual m1 and M1 teeth of Apodemus spp. from particular Pleistocene biozones superimposed onto a plot of variation ranges for the respective variables for the Recent Apodemus sample (based on the discrimination analysis of metric variables of M1 and m1).
Text-fig. 4. Bivariate plots of the upper teeth (M2 – P3) of small to medium sized Miocene hyaenodonts from African localities. Data source: Pilgrim (1912, 1914, 1932), Colbert (1935), Savage (1965), Barry (1988), Morales et al. (1998a, 2007), Holroyd (1999), Rasmussen et al. (2009), Borths et al. (2016), Borths and Seiffert (2017). in New Hyaenodonts (Ferae, Mammalia) From The Early Miocene Of Napak (Uganda), Koru (Kenya) And Grillental (Namibia)
Text-fig. 4. Bivariate plots of the upper teeth (M2 – P3) of small to medium sized Miocene hyaenodonts from African localities. Data source: Pilgrim (1912, 1914, 1932), Colbert (1935), Savage (1965), Barry (1988), Morales et al. (1998a, 2007), Holroyd (1999), Rasmussen et al. (2009), Borths et al. (2016), Borths and Seiffert (2017).
Text-fig. 3. Bivariate plots of the lower teeth (m3 – m2) of small to medium sized Miocene hyaenodonts from African localities. Data source: Pilgrim (1912, 1932), Colbert (1935), Savage (1965), Barry (1988), Morales et al. (1998a, 2003, 2007, 2008, 2010), Holroyd (1999), Morlo et al. (2007), Rasmussen et al. (2009), Borths et al. (2016), Borths and Seiffert (2017). in New Hyaenodonts (Ferae, Mammalia) From The Early Miocene Of Napak (Uganda), Koru (Kenya) And Grillental (Namibia)
Text-fig. 3. Bivariate plots of the lower teeth (m3 – m2) of small to medium sized Miocene hyaenodonts from African localities. Data source: Pilgrim (1912, 1932), Colbert (1935), Savage (1965), Barry (1988), Morales et al. (1998a, 2003, 2007, 2008, 2010), Holroyd (1999), Morlo et al. (2007), Rasmussen et al. (2009), Borths et al. (2016), Borths and Seiffert (2017).
Text-fig. 7. Bivariate plots of the upper teeth (M2, M1, P4) and lower teeth (m3, m2, p4) of large Miocene hyaenodonts from Eurasian and African localities. Data source: Stromer (1926), Savage (1965), Barry (1988), Ginsburg (1999), Holroyd (1999), Morales et al. (2003, 2007, 2008, 2010), Morlo et al. (2007), Rasmussen and Gutiérrez (2009), Borths et al. (2016). in New Hyaenodonts (Ferae, Mammalia) From The Early Miocene Of Napak (Uganda), Koru (Kenya) And Grillental (Namibia)
Text-fig. 7. Bivariate plots of the upper teeth (M2, M1, P4) and lower teeth (m3, m2, p4) of large Miocene hyaenodonts from Eurasian and African localities. Data source: Stromer (1926), Savage (1965), Barry (1988), Ginsburg (1999), Holroyd (1999), Morales et al. (2003, 2007, 2008, 2010), Morlo et al. (2007), Rasmussen and Gutiérrez (2009), Borths et al. (2016).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.