Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
6,030
datasets available to search
ShareScore release 0.9.0
Dataset results
6,030 results for “Caving”
Figure 1 in New genera of Bogidiellidae (Amphipoda: Gammaridea) from SW Pacific and Mediterranean marine caves
Figure 1. Fidelidiella pectinata gen. et sp. nov. (holotype). (A) Body, lateral aspect; (B) right antennule, lateral; (C) detail of accessory flagellum of latter; (D) right antenna, lateral; (E) detail of right epimeral plates, lateral.
Fig. 8. Male genitalia. A, C, E, G, I, K. Dorsal view. B, D, F, H, J, L. Ventral view. A–B in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 8. Male genitalia. A, C, E, G, I, K. Dorsal view. B, D, F, H, J, L. Ventral view. A–B. Tachycines (Gymnaeta) quadratus sp. nov., holotype, ♂ (HBU). C–D. Tachycines (Gymnaeta) shiziensis sp. nov., holotype, ♂ (HBU). E–F. Tachycines (Gymnaeta) sparsispinus sp. nov., holotype, ♂ (HBU). G–H. Tachycines (Gymnaeta) papilious sp. nov., holotype, ♂ (HBU). I–J. Tachycines (Gymnaeta) latellai (Rampini & Di Russo, 2008), ♂. K–L. Tachycines (Gymnaeta) omninocaecus (Gorochov, Rampini & Di Russo, 2006), ♂.
Fig. 7 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 7. Tachycines (Gymnaeta) omninocaecus (Gorochov, Rampini & Di Russo, 2006). A–F, I. ♂. A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view. I. Hind basitarsus in lateral view. — G–H. ♀. G. Subgenital plate. H. Ovipositor in lateral view.
Fig. 6 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 6. Tachycines (Gymnaeta) latellai (Rampini & Di Russo, 2008). A–F, I. ♂. A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. — D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view. I. Hind basitarsus in lateral view. — G–H. ♀. G. Subgenital plate. H. Ovipositor in lateral view.
Fig. 5 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 5. Tachycines (Gymnaeta) liboensis Zhu, Chen & Shi, 2020. A–F, I. ♂. A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view. I. Hind basitarsus in lateral view. — G–H. ♀. G. Subgenital plate. H. Ovipositor in lateral view.
Fig. 3 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 3. Tachycines (Gymnaeta) sparsispinus sp. nov. A–F, I. Paratype, ♂ (HBU). A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view.I. Hind tarsus in lateral view. — G–H. Paratype, ♀ (HBU). G. Subgenital plate. H. Ovipositor in lateral view.
Fig. 2 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 2. Tachycines (Gymnaeta) shiziensis sp. nov. A–F. Holotype, ♂ (HBU). A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view.
Fig. 4 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 4. Tachycines (Gymnaeta) papilious sp. nov. A–F. Holotype, ♂ (HBU). A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view.
Fig. 1 in Description of four new species of the subgenus Tachycines (Gymnaeta) Adelung, 1902 (Orthoptera: Rhaphidophoridae) from caves in China and additional notes on some previously known species
Fig. 1. Tachycines (Gymnaeta) quadratus sp. nov. A–F, I. Holotype, ♂ (HBU). A–C. Head and pronotum. A. Frontal view. B. Lateral view. C. Dorsal view. D–F. Apex of abdomen. D. Lateral view. E. Dorsal view. F. Ventral view. I. Hind tarsus in lateral view. — G–H. Paratype, ♀ (HBU). G. Subgenital plate. H. Ovipositor in lateral view.
Fig. 7 in Cave Shrimps Of The Genus Edoneus Holthuis, 1978, From Luzon, The Philippines, With Descriptions Of Three New Species (Crustacea: Decapoda: Atyidae)
Fig. 7. Edoneus marulas, new species: A, first pereiopod; B, second pereiopod; C, third pereiopod; D, dactylus of third pereiopod; E, fifth pereiopod; F, dactylus of fifth pereiopod; G, male first pleopod; H, male second pleopod; I, uropodal diaeresis. Scale bars: A–C, E = 0.5 mm; D, F, I = 0.1 mm; G, H = 0.2 mm; (male, cl 3.9 mm, paratype, ZRC).
Fig. 6 in Cave Shrimps Of The Genus Edoneus Holthuis, 1978, From Luzon, The Philippines, With Descriptions Of Three New Species (Crustacea: Decapoda: Atyidae)
Fig. 6. Edoneus marulas, new species: A, cephalothorax and cephalic appendages, lateral view; B, telson; C, distal portion of telson; D, preanal carina; E, scaphocerite; F, mandible; G, maxillula; H, maxilla; I, first maxilliped; J, second maxilliped; K, third maxilliped. Scale bars: A = 1 mm; B, E = 0.5 mm; C = 0.1 mm; D, F–K = 0.3 mm. (male, cl 3.9 mm, paratype, ZRC).
Fig. 3 in Cave Shrimps Of The Genus Edoneus Holthuis, 1978, From Luzon, The Philippines, With Descriptions Of Three New Species (Crustacea: Decapoda: Atyidae)
Fig. 3. Edoneus erwini, new species: A, first pereiopod; B, second pereiopod; C, third pereiopod; D, dactylus of third pereiopod; E, fifth pereiopod; F, dactylus of fifth pereiopod; G, male first pleopod; H, male second pleopod; I, edopod of male first pleopod; J, appendix masculina of male second pleopod; K, uropodal diaeresis. Scale bars: A–C, E = 0.5 mm; D, F, K = 0.1 mm; G, H = 0.3 mm; I, J = 0.2 mm (male, cl 4.5 mm, paratype, ZRC).
Fig. 5 in Cave Shrimps Of The Genus Edoneus Holthuis, 1978, From Luzon, The Philippines, With Descriptions Of Three New Species (Crustacea: Decapoda: Atyidae)
Fig. 5. Edoneus sketi, new species: A, first pereiopod; B, second pereiopod; C, third pereiopod; D, dactylus of third pereiopod; E, fifth pereiopod; F, dactylus of fifth pereiopod; G, male first pleopod; H, male second pleopod; I, uropodal diaeresis. Scale bars: A–C, E = 0.5 mm; D, F, I = 0.1 mm; G, H = 0.2 mm; (male, cl 4.1 mm, paratype, ZRC).
Fig. 2 in Cave Shrimps Of The Genus Edoneus Holthuis, 1978, From Luzon, The Philippines, With Descriptions Of Three New Species (Crustacea: Decapoda: Atyidae)
Fig. 2. Edoneus erwini, new species: A, cephalothorax and cephalic appendages, lateral view; B, telson; C, distal portion of telson; D, preanal carina; E, scaphocerite; F, mandible; G, maxillula; H, maxilla; I, first maxilliped; J, second maxilliped; K, third maxilliped. Scale bars: A, E = 1 mm; B, K = 0.5 mm; C = 0.1 mm; D, F–J = 0.3 mm. (male, cl 4.5 mm, paratype, ZRC).
Fig. 4 in Cave Shrimps Of The Genus Edoneus Holthuis, 1978, From Luzon, The Philippines, With Descriptions Of Three New Species (Crustacea: Decapoda: Atyidae)
Fig. 4. Edoneus sketi, new species: A, cephalothorax and cephalic appendages, lateral view; B, telson; C, distal portion of telson; D, preanal carina; E, scaphocerite; F, mandible; G, maxillula; H, maxilla; I, first maxilliped; J, second maxilliped; K, third maxilliped. Scale bars: A = 1 mm; B, K, E = 0.5 mm; C = 0.1 mm; D, F–J = 0.3 mm. (male, cl 4.1 mm, paratype, ZRC).
Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.
Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.
Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.