Find research datasets worth reusing

Figs 1–4 in Macrocera rohaceki sp. nov. and other interesting records of Keroplatidae (Diptera) from southern and central Europe, with DNA sequence data

Figs 1–4. Macrocera rohaceki sp. nov., male: 1 – wing; 2 – terminalia, ventral view; 3 – terminalia, dorsal view, tergite 9 removed; 4 – tergite 9 and cerci, external view. Scale bars = 0.1 mm.

Figs 20–25 in Macrocera rohaceki sp. nov. and other interesting records of Keroplatidae (Diptera) from southern and central Europe, with DNA sequence data

Figs 20–25. Isoneuromyia semirufa (Meigen, 1818), male: 20 – wing; 21 – thorax dorsally; 22 – habitus; 23 – terminalia, ventral view; 24 – terminalia, dorsal view, tergite 9 removed; 25 – tergite 9 and cerci, external view.

Figs 17–19. 17 in Macrocera rohaceki sp. nov. and other interesting records of Keroplatidae (Diptera) from southern and central Europe, with DNA sequence data

Figs 17–19. 17 – habitus of Isoneuromyia pseudochracea (Landrock, 1925); 18 – male of Isoneuromyia czernyi (Strobl, 1909) visiting flower of Chaerophyllum aromaticum (Apiaceae); 19 – female of Isoneuromyia czernyi (Strobl, 1909). (Photos by Jan Ševčík and Michal Tkoč).

Figs 5–10 in Macrocera rohaceki sp. nov. and other interesting records of Keroplatidae (Diptera) from southern and central Europe, with DNA sequence data

Figs 5–10. Isoneuromyia czernyi (Strobl, 1909), male: 5 – wing; 6 – thorax, dorsal view; 7 – habitus; 8 – terminalia, ventral view; 9 – terminalia, dorsal view, tergite 9 removed; 10 – tergite 9 and cerci, external view.

opencc-by-4.0Dec 2010View details →

Figs. 1–4 in Copelatus sibelaemontis sp. nov. (Coleoptera: Dytiscidae) from the Moluccas with generic assignment based on morphology and DNA sequence data

Figs. 1–4. Copelatus sibelaemontis sp. nov. 1 – habitus; 2 – median lobe in ventral view; 3 – the same in lateral view; 4 – lateral lobe (paramere).

Fig. 5 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 5. Maximum likelihood tree inferred from concatenated COI, ITS-1 and 28SrRNA sequence data. Species from the Western Palearctic region are marked by inverted triangles, those from Ethiopia by circles, and those from the Oriental-Australasia region by coloured triangles, with colours indicating geographical location (red: Southeast Asia; blue: East Asia; purple: India; orange: Australia). The three main clades in the tree with strong bootstrap support at the base are highlighted in blue (Clade I), green (Clade II), and beige (Clade III). Branch length for S. mediterranea was 0.37 nucleotide substitutions per nucleotide site.

Fig. 3. Dugesia batuensis. a, A in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 3. Dugesia batuensis. a, A living specimen with visible eyes and clearly pigmented body; b, Karyogram (2n=14).

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.

Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

Fig 1 in Evolutionary relationships of Macaca fascicularis fascicularis (Raffles 1821) (Primates: Cercopithecidae) from Singapore revealed by Bayesian analysis of mitochondrial DNA sequences

Fig 1. Map of Southeast Asia showing the approximate location of the new (Singapore and Bali) and GenBank sequences included in the study. Numbers correspond to the following locations (haplotype IDs in parentheses): ★, Singapore (Sing1–3); 1, Vietnam (Viet1 & 2); 2, Cambodia (Camb1 & 2); 3, Thailand (Thai1); 4, Thailand (Thai2); 5, Malaysia (Selangor1 & 2); 6, Malaysia (Johor); 7, south Sumatra, Indonesia (Sumatra1 & 2, Java1); 8, Java (Java1); 9, Kalimantan, Borneo (Borneo3); 10, Sarawak, Borneo (Borneo1); 11, Sepilok, Borneo (Borneo2); 12, Bali, Indonesia (Bali1 & 2); 13, Sibuyan, Philippines (Phil1); 14, Bangkok, Thailand (Thai3 & 4); 15, Malaysia (W. Malay); 16, Malaysia (E. Malay2); 17 Malaysia (E. Malay1);18, north Sumatra (Sumatra3–6, 9); 19, west Borneo, Indonesia (Borneo9); 20, west Borneo, Indonesia (Borneo4–7); 21, central Borneo, Indonesia (Borneo4 & 6); 22, Bangka, south Sumatra (Sumatra 7 & 8); 23, Java, Indonesia (Java2 & 3); 24, northeast Borneo, Indonesia (Borneo8); 25, Mindanao, Philippines (Phil2); 26, Timor (Timor). Several Borneo haplotypes appear in multiple locations.

Fig 4. Median-joining haplotype network for M in Evolutionary relationships of Macaca fascicularis fascicularis (Raffles 1821) (Primates: Cercopithecidae) from Singapore revealed by Bayesian analysis of mitochondrial DNA sequences

Fig 4. Median-joining haplotype network for M. fascicularis. The size of the circular nodes representing haplotypes is proportional to the number of sequences comprising the haplotype. Shading of circular nodes corresponds to general geographic groupings including Sundaic islands (white), mainland Indochina (gray), Malay Peninsula and northern Sumatra (dark gray), and Singapore (black). Haplotype identifications are presented in Table 1.

Fig 3 in Evolutionary relationships of Macaca fascicularis fascicularis (Raffles 1821) (Primates: Cercopithecidae) from Singapore revealed by Bayesian analysis of mitochondrial DNA sequences

Fig 3. Phylogenetic tree topology from Bayesian inference of 12S/tRNA-val/16S mtDNA sequences using a Birth-Death speciation tree prior, and HYK+G+I nucleotide substitution model in BEAST v2.1.3. Lettered identifications for clades are presented below the branches at major nodes. Posterior probabilities are displayed above the branches at nodes. Numbers in parentheses appearing with haplotype identifications are presented in Table 1, and correspond to numbered locations presented on the Figure 1 map. The Singapore haplotypes form two phylogenetic subgroupings, one from the Bukit Timah Nature Reserve (Sing1) and the other from the Central Catchment Nature Reserve (Sing2 & Sing3).

opencc-by-4.0Dec 2016View details →

Fig. 4 in Two new Oriental species of Paramanota Tuomikoski (Diptera: Mycetophilidae), with DNA sequence data

Fig. 4. Molecular affiliation of Paramanota rodzayi based on Maximum likelihood analysis of the combined dataset (12S, 28S, and COI). The numbers below the branches indicate bootstrap support (BS) values above 75.

opencc-by-4.0Dec 2016View details →

Fig. 3. Paramanota bifalx Hippa, 2010 in Two new Oriental species of Paramanota Tuomikoski (Diptera: Mycetophilidae), with DNA sequence data

Fig. 3. Paramanota bifalx Hippa, 2010 (Thailand). A, Right half of hypopygium, dorsal view; B, Median lobes and the ventral lobe of gonostylus, dorsal view. Scale bar = 0.1 mm. cm = comb-like row of pale lamellae, cr = cercus, gs d = dorsal lobe of gonostylus, f l = curved finger-like lobe, gs v = ventral lobe of gonostylus, gx = gonocoxa, gx l = ventral gonocoxal lobe, h l = hand-like lobe, hp = hypoproct, tg 9 = tergite 9, tg 10 = tergite 10.

opencc-by-4.0Dec 2016View details →

Fig. 1 in Two new Oriental species of Paramanota Tuomikoski (Diptera: Mycetophilidae), with DNA sequence data

Fig. 1. Paramanota rodzayi, new species (holotype). A, Hypopygium, dorsal view; B, Hypopygium, ventral view; C, Ventral and median lobe of gonostylus, anteroventral view; D, Aedeagus with associated structures, dorsal view; E, Antennal flagellomere 4, lateral view. Scale bar = 0.1 mm. cr = cercus, gs d = dorsal lobe of gonostylus, gs m = median lobe of gonostylus, gs v = ventral lobe of gonostylus, gx = gonocoxa, gx l = ventral gonocoxal lobe, hp = hypoproct, tg 9 = tergite 9, tg 10 = tergite 10.

Fig 2 in Evolutionary relationships of Macaca fascicularis fascicularis (Raffles 1821) (Primates: Cercopithecidae) from Singapore revealed by Bayesian analysis of mitochondrial DNA sequences

Fig 2. Map of central Singapore showing the sampling locations in the Bukit Timah (BTNR) and Central Catchment (CCNR) Nature Reserves. Map created using ArcGIS® (ESRI® 2015).

opencc-by-4.0Aug 2003View details →

Fig. 24 in Phylogenetic Studies On Didelphid Marsupials Ii. Nonmolecular Data And New Irbp Sequences: Separate And Combined Analyses Of Didelphine Relationships With Denser Taxon Sampling

Fig. 24. Tlacuatzin canescens, photographed by Gerardo Ceballos in March 1995 at the ChamelaCuixmala Biosphere Reserve, Jalisco, Mexico. Specimens from southern populations (especially topotypical material from Oaxaca) are markedly grayer than this individual.

opencc-by-4.0Aug 2003View details →

Fig. 12 in Phylogenetic Studies On Didelphid Marsupials Ii. Nonmolecular Data And New Irbp Sequences: Separate And Combined Analyses Of Didelphine Relationships With Denser Taxon Sampling

Fig. 12. Bivariate comparison of two dental proportions discussed in the text, with illustrated examples of contrasting morphologies. Closed curves delimit sets of taxa assigned to alternative states of character 57. Taxon labels: 1, Caluromys lanatus; 2, Caluromys philander; 3, Caluromysiops irrupta; 4, Chironectes minimus; 5, Didelphis albiventris; 6, Didelphis marsupialis; 7, Didelphis virginiana; 8, Glironia venusta; 9, Gracilinanus microtarsus; 10, Lestodelphys halli; 11, Lutreolina crassicaudata; 12, Marmosa canescens; 13, Marmosa lepida; 14, Marmosa mexicana; 15, Marmosa murina; 16, Marmosa robinsoni; 17, Marmosa rubra; 18, Marmosops impavidus; 19, Marmosops incanus; 20, Marmosops noctivagus; 21, Marmosops parvidens; 22, Marmosops pinheiroi; 23, Metachirus nudicaudatus; 24, Micoureus demerarae; 25, Micoureus paraguayanus; 26, Micoureus regina; 27, Monodelphis adusta; 28, Monodelphis brevicaudata; 29, Monodelphis emiliae; 30, Monodelphis theresa; 31, Philander frenata; 32, Philander mcilhennyi; 33, Philander opossum; 34, Thylamys pallidior; 35, Thylamys venustus. Other labels: MC, metacrista; PC, postprotocrista.