Find research datasets worth reusing

opencc-by-nc-4.0Oct 2024View details →

Matrix Framework for Analysis: Building a Matrix from Advanced Projects

This raw dataset is part of a Framework Global - Matrix that enables a comprehensive and holistic assessment, simplifying comparisons and guiding decision-makers in selecting the alternatives that offer the greatest value in terms of financial return, social and environmental impact, and regulatory compliance. To streamline the analysis and comparison of indicators, the author utilized categories linked to Sustainable Competitiveness and the World Business Council for Sustainable Development (WBCSD). As a result, the indicators contribute to the functionality of the matrix, facilitating the identification of key projects related to the desired area and enabling future application of the data in sustainability-focused initiatives.

opencc-by-4.0Jan 2024View details →

CER.TOSA Matrix

https://asud.net/progetto/cer-tosa-community-for-energy-torpignattara-sustainability-action/

Data Matrix Theme-Specific Analysis of the Recommendation on Science and Scientific Researchers (RSSR): Public and Stakeholder Engagement

This Table sets out findings from the mapping exercise conducted as part of the objectives of subtask 6.1 of the RRING project. Aim: Alignment of RRI to advance the UN SDGs. Objectives: <ul> <li>Mapping the RSSR to the SDGs </li> </ul> Mapping the RSSR to the SDGs is aimed at providing new perspectives, ideas and approaches that can help to improve the operationalization and implementation of each SDG, by facilitating the integration of RRI (or RRI-like) practices in the SDGs, to make them more achievable. The impact of the new perspectives, ideas and approaches in SDG operationalization and implementation will be aimed at the level of national and international policy (making); future research and innovation projects (in industry and academia); as well as education and training of researchers, policy makers and other stakeholders. Two documents were used for this task: <ul> <li>2017 Recommendation on Science and Scientific Researchers ([RSSR], UNESCO), and</li> <li>the United Nations 2030 Agenda for Sustainable Development with the 17 Sustainable Development Goals (SDGs).</li> </ul>

Data Matrix Theme-Specific Analysis of the Recommendation on Science and Scientific Researchers (RSSR): Ethics and Ethical Governance

opencc-by-4.0Jun 2020View details →

Metabolic pathway prediction using non-negative matrix factorization with improved precision

We include samples of various data types used in the work "Metabolic pathway prediction using non-negative matrix factorization with improved precision" More information about the software package and instructions are provided in <a href="https://github.com/hallamlab/triUMPF">hallamlab/triUMPF</a>

Source-specific light absorption by carbonaceous components in the complex aerosol matrix from yearly filter-based measurements

Data presented in the main figures of the peer-reviewed journal article "Source-specific light absorption by carbonaceous components in the complex aerosol matrix from yearly filter-based measurements" by Moschos et al. (2021) in Atmospheric Chemistry and Physics (https://doi.org/10.5194/acp-2020-1293).

opencc-by-4.0Nov 2020View details →

Concatenated matrix from: Pristimantis trachyblepharis species group, a clade of miniaturized frogs: description of four new species and insights into the evolution of body size within the genus

Matrix in nexus format that include sequences of RAG1 (1 - 600 bp), 16S (601 - 1912 bp), and 12S (1913 - 2819 bp) genes for 347 specimens belonging to the genus Pristimantis, in addition to several specimens of neotropical frog genera as outgroups.

Advanced Glycation End-products are Retained in Decellularized Muscle Matrix Derived from Aged Skeletal Muscle

Advanced glycation end-products (AGEs) accrue on skeletal muscle collagen in old age, stiffening the matrix and increasing inflammation. Whether decellularized biomaterials derived from aged muscle would suffer from increased AGE cross-links is unknown. We hypothesized that DMM from old muscle would have increased collagen, collagen cross-linking, stiffness, and AGEs. We isolated, decellularized, and characterized gastrocnemii of 1-month, 2-month, and 20-month old C57BlJ6 mice to determine age-dependent changes to collagen in muscle and decellularized muscle matrix (DMM). Total hydroxyproline and soluble hydroxyproline after proteinase K digestion were measured to assay collagen levels and cross-linking, respectively. Muscle fiber and DMM stiffness was determined using atomic force microscopy (AFM).  AGE ELISAs were used to test AGE levels, and the effect of AGE cross-link breaker ALT-711 on DMM was tested. We determined age-dependent increases in collagen amount, cross-linking, and general stiffness are retained on DMM. DMM from old muscle was stiffer compared to younger groups according to shifts in AFM modulus distribution. We measured an increase in AGE-specific cross-links with old age in whole muscle and observed that these changes are countered in DMM by AGE cross-link breaker ALT-711. Future study investigating and countering the biological effects of old age on DMM is warranted.

opencc-by-4.0Mar 2021View details →

STK Probability Matrix for the complete STK PamChip

This dataset has a completed calculated posterior probabilities for each Kinase that could phosphorylate each peptide on the PamGene STK PamChip version 87102

opencc-by-4.0Sep 2017View details →

Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)

Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.

opencc-by-4.0Aug 2017View details →

Text-fig. 5. Fossil mammals from the Oligocene of Djebel Bou Gobrine, Tunisia, stored in the ONM Museum, El Charguia, Tunis. a–b) (?)Phiomia sp. maxilla containing parts of two upper molars (probably M1/ and M2/) (a – occlusal view, b – buccal view); c–d) anthracothere distal tibia in coarse sand matrix (c – plantar view, d – distal view) (all in scale). in Arsinoitherium (Embrithopoda) And Other Large Mammals And Plants From The Oligocene Of Tunisia

Text-fig. 5. Fossil mammals from the Oligocene of Djebel Bou Gobrine, Tunisia, stored in the ONM Museum, El Charguia, Tunis. a–b) (?)Phiomia sp. maxilla containing parts of two upper molars (probably M1/ and M2/) (a – occlusal view, b – buccal view); c–d) anthracothere distal tibia in coarse sand matrix (c – plantar view, d – distal view) (all in scale).

opencc-zeroDec 2006View details →

FIG. 4 in The data matrix

FIG. 4. — An example of a phylo-phenetic approach used in biogeography, similar to Parsimony Analysis of Endemicity (PAE) analysis: A, list of taxa T1-T3 and the areas they occupy (A, B and C); B, matrix in which similarities are grouped; C, the resulting phylophenogram in which areas B and C are grouped together by the component BC derived from T2 and (possibly) T3. Note that taxa T2 and T3 do not occur in the same areas and therefore do not share any direct relationship.

Text-fig. 7. Number of required character state changes under parsimony (steps) for various positions of Mugideiriflora portugallica, based on the Doyle and Endress character matrix and backbone tree (Doyle and Endress 2000, 2014). in Multiparted, Apocarpous Flowers From The Early Cretaceous Of Eastern North America And Portugal

Text-fig. 7. Number of required character state changes under parsimony (steps) for various positions of Mugideiriflora portugallica, based on the Doyle and Endress character matrix and backbone tree (Doyle and Endress 2000, 2014).

Text-fig. 8. Number of required character state changes under parsimony (steps) for various positions of Lambertiflora elegans, based on the Doyle and Endress character matrix and backbone tree (Doyle and Endress 2000, 2014). in Multiparted, Apocarpous Flowers From The Early Cretaceous Of Eastern North America And Portugal

Text-fig. 8. Number of required character state changes under parsimony (steps) for various positions of Lambertiflora elegans, based on the Doyle and Endress character matrix and backbone tree (Doyle and Endress 2000, 2014).

Text-fig. 9. Number of required character state changes under parsimony (steps) for various positions of Atlantocarpus virginiensis, based on the Doyle and Endress character matrix and backbone tree (Doyle and Endress 2000, 2014). in Multiparted, Apocarpous Flowers From The Early Cretaceous Of Eastern North America And Portugal

Text-fig. 9. Number of required character state changes under parsimony (steps) for various positions of Atlantocarpus virginiensis, based on the Doyle and Endress character matrix and backbone tree (Doyle and Endress 2000, 2014).

Text-fig. 2. Quinquala obovata gen. et sp. nov., fruits from Kisinger Lakes flora, Wyoming. a: Lateral view of fruit on long pedicel. Note the two lateral wings and pair of longitudinal grooves representing wings extending into the matrix. UF 19376-60038. b: Lateral view of fruit on long, bent pedicel. Note the perianth scar at the base of the fruit (arrow). UF 19376-60023a. c: Lateral view of fruit on long, slightly bent pedicel. Note the pair of longitudinal grooves representing wings extending into the matrix, and in Winged Fruits Of Rutaceous Affinity From The Eocene Of Western North America

Text-fig. 2. Quinquala obovata gen. et sp. nov., fruits from Kisinger Lakes flora, Wyoming. a: Lateral view of fruit on long pedicel. Note the two lateral wings and pair of longitudinal grooves representing wings extending into the matrix. UF 19376-60038. b: Lateral view of fruit on long, bent pedicel. Note the perianth scar at the base of the fruit (arrow). UF 19376-60023a. c: Lateral view of fruit on long, slightly bent pedicel. Note the pair of longitudinal grooves representing wings extending into the matrix, and

opencc-by-4.0Dec 2017View details →

Text-fig. 10. Phylogenetic relationships of Miocene hyaenodonts (for definitions of character states see Table 2). The data matrix was compiled in MacClade 4.05 and run in PAUP 4.0b10 (Macintosh version). We chose Cimolestes magnus CLEMENS et RUSSELL, 1965, (additional data from Lillegraven 1969), as the outgroup. The unordered and unweighted analysis produced 16 trees. a: Majority-rule consensus. b: Strict consensus. Consistency index (CI): 0.5882; Homoplasy index (HI): 0.4118; Retention index (RI): 0.7742. in New Hyaenodonts (Ferae, Mammalia) From The Early Miocene Of Napak (Uganda), Koru (Kenya) And Grillental (Namibia)

Text-fig. 10. Phylogenetic relationships of Miocene hyaenodonts (for definitions of character states see Table 2). The data matrix was compiled in MacClade 4.05 and run in PAUP 4.0b10 (Macintosh version). We chose Cimolestes magnus CLEMENS et RUSSELL, 1965, (additional data from Lillegraven 1969), as the outgroup. The unordered and unweighted analysis produced 16 trees. a: Majority-rule consensus. b: Strict consensus. Consistency index (CI): 0.5882; Homoplasy index (HI): 0.4118; Retention index (RI): 0.7742.

opencc-by-4.0Aug 2019View details →

Text-fig. 6. a. Vertical section showing part of body-chamber of a Cenoceras in the top of the Main Cenoceras Bed associated with attached oysters below and stringers of crinoid debris below and stretching laterally. Coin 23 mm in diameter. b. Complete lateral half of conch showing intact and elastically deformed septa on which rests crinoid debris that spreads across the exposed septa and onto the adjacent substrate. Conch approximately 180 mm in diameter. c. Individual showing dispersed crinoid and molluscan debris within body-chamber and septa in the crushed inner whorls that have taken a sparite cement prior to, and after having undergone brittle deformation. 160 mm in diameter. d. Vertically embedded specimen showing the loss of septa in the inner whorls that are infilled with matrix mottled by bioturbation. Tape measure provides scale. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas

Text-fig. 6. a. Vertical section showing part of body-chamber of a Cenoceras in the top of the Main Cenoceras Bed associated with attached oysters below and stringers of crinoid debris below and stretching laterally. Coin 23 mm in diameter. b. Complete lateral half of conch showing intact and elastically deformed septa on which rests crinoid debris that spreads across the exposed septa and onto the adjacent substrate. Conch approximately 180 mm in diameter. c. Individual showing dispersed crinoid and molluscan debris within body-chamber and septa in the crushed inner whorls that have taken a sparite cement prior to, and after having undergone brittle deformation. 160 mm in diameter. d. Vertically embedded specimen showing the loss of septa in the inner whorls that are infilled with matrix mottled by bioturbation. Tape measure provides scale.

opencc-by-4.0Aug 2019View details →

Text-fig. 7. a. Worn section through a horizontally bedded body-chamber and phragmocone, body-chamber showing oyster attached to inside of aperture as well as burrow mottling. Tape measure provides scale. b. Body-chamber and crushed phragmocone with body-chamber and phragmocone entirely filled with bioturbated matrix containing stringers of crinoid and molluscan debris. Flank of phragmocone encrusted by oysters. Tape measure for scale. c. Complex of Thallassinoides and Diplocraterion burrows associated with conch that has been eroded out by wave action. A few 'Ghostly' fragments of ammonite are also present. Original scope of the image approximately 400 mm. c. Verically embedded conch with largely intact septa and camera infilled with burrowed matrix containing crinoid debris. Tape measure for scale. in 'Cenoceras Islands' In The Blue Lias Formation (Lower Jurassic) Of West Somerset, Uk: Nautilid Dominance And Influence On Benthic Faunas

Text-fig. 7. a. Worn section through a horizontally bedded body-chamber and phragmocone, body-chamber showing oyster attached to inside of aperture as well as burrow mottling. Tape measure provides scale. b. Body-chamber and crushed phragmocone with body-chamber and phragmocone entirely filled with bioturbated matrix containing stringers of crinoid and molluscan debris. Flank of phragmocone encrusted by oysters. Tape measure for scale. c. Complex of Thallassinoides and Diplocraterion burrows associated with conch that has been eroded out by wave action. A few 'Ghostly' fragments of ammonite are also present. Original scope of the image approximately 400 mm. c. Verically embedded conch with largely intact septa and camera infilled with burrowed matrix containing crinoid debris. Tape measure for scale.