Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
9,029
datasets available to search
ShareScore release 0.9.0
Dataset results
9,029 results for “Asia”
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 2. Dugesia species from Malaysia and Thailand. a, Living D. batuensis in a shallow stream in the Dark Cave, Batu Caves, Malaysia; b, Living D. deharvengi in a freshwater pool inside Tham Nen Noi, Thailand.
Fig. 1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 1. Dugesia collection sites in Malaysia and Thailand. a, Dark Cave at Batu Caves, Peninsular Malaysia; b, Topological details of the area around Batu Caves; c, Tham Nen Noi, Thailand; d, Topological details of the area around Tham Nen Noi. Maps were created using the ggmap R package (Kahle & Wickham, 2013). Image source: Google Maps.
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Fig. 5 in Is the northern chevrotain, Tragulus williamsoni Kloss, 1916, a synonym or one of the least-documented mammal species in Asia?
Fig. 5. Camera trap photograph of a chevrotain taken at Xishuangbanna forest dynamics plot, Mengla County, Yunnan, China likely to be Tragulus williamsoni. Photo by Cao Lin from Zhang et al. (2016) reproduced with permission.
Fig. 3 in Is the northern chevrotain, Tragulus williamsoni Kloss, 1916, a synonym or one of the least-documented mammal species in Asia?
Fig. 3. Principal Component Analysis of nine measurements on 60 Tragulus skulls from mainland Asia. Brown dots = T. napu (n = 13); red dots = T. kanchil (n = 42); green dots = T. versicolor (n = 3), blue dot = T. williamsoni (n = 1); magenta dot = Yunnan specimen KIZ 6401.
Fig. 4 in Is the northern chevrotain, Tragulus williamsoni Kloss, 1916, a synonym or one of the least-documented mammal species in Asia?
Fig. 4. Skulls of adult Tragulus spp. (ventral view). Top to bottom: KIZ 6401, T. napu (ZRC 4.4753, Nakhon Si Thammarat, Thailand), T. kanchil (ZRC 4.4800, Kompong Sun, Cambodia). Scale bar = 10 mm.
Figs 8-13 in Contribution to the Ichneumoninae (Hymenoptera, Ichneumonidae) of Southeastern Asia: 3. Heresiarchini
Figs 8-13: Propodeum of ♀♀ of: (8) Aglaojoppa parafemorata nov.sp. HT, (9) Coelichneumon fulvipes (CAMERON), (10) Coelichneumon fulvipennoides nov.sp. HT, (11) Coelichneumon hopponsis (MATSUMURANA), (12) Coelichneumon scopator nov.sp. HT, (13) Coelichneumon superomediae nov.sp. HT.
Figs 1-4 in Contribution to the Ichneumoninae (Hymenoptera, Ichneumonidae) of Southeastern Asia: 3. Heresiarchini
Figs 1-4: Heads seen from dorsal of: (1) Aglaojoppa parafemorata nov.sp. HT, (2) Coelichneumon fulvipennoides nov.sp. HT, (3) Coelichneumon scopator nov.sp. HT, (4) Coelichneumon superomediae nov.sp. HT.
Figs 14-19 in Contribution to the Ichneumoninae (Hymenoptera, Ichneumonidae) of Southeastern Asia: 3. Heresiarchini
Figs 14-19: Metasomal tergites of ♀♀ of: (14) Aglaojoppa parafemorata nov.sp. HT, (15) Coelichneumon fulvipes (CAMERON), (16) Coelichneumon fulvipennoides nov.sp. HT, (17) Coelichneumon hopponsis (MATSUMURANA), (18) Coelichneumon scopator nov.sp. HT, (19) Coelichneumon superomediae nov.sp. HT.
Fig. 6 in Areas of endemism in Thailand: has historical partitioning between seasonally dry lowland and aseasonal moist mountain forests shaped biodiversity in Southeast Asia?
Fig. 6. Relationship between elevation and geographical range of Hybos spp. in Thailand. The number of 1° grids in which a species was recorded is plotted against the median elevation of all records. Line fitted by linear regression in PAST (r2=0.1026).
Fig. 5 in Areas of endemism in Thailand: has historical partitioning between seasonally dry lowland and aseasonal moist mountain forests shaped biodiversity in Southeast Asia?
Fig. 5. EZPAE down-weighted against homoplasy, using altitudinally zoned mountain ranges as OGU, 'characters' made additive. Strict consensus tree of two equally parsimonious trees (CI = 0.716, RI = 0.534) produced by maximum parsimony analysis with weighted 'characters' and TBR branch swapping in TNT. Symmetrical resampling support is given under the nodes. Alphabetic codes of termini correspond with mountain ranges as abbreviated in Fig. 3; the suffixes 'low' & 'high' refer to low (<1,250m) and high (>1,250m) elevation sample data.
Fig. 4 in Areas of endemism in Thailand: has historical partitioning between seasonally dry lowland and aseasonal moist mountain forests shaped biodiversity in Southeast Asia?
Fig. 4. EZPAE down-weighted against homoplasy, using altitudinally zoned mountain ranges as OGU, 'characters' made non-additive. Strict consensus tree of four equally parsimonious trees (CI = 0.674, 0.580) produced by maximum parsimony analysis with weighted 'characters' and TBR branch swapping in TNT. Symmetrical resampling support is given under the nodes. Alphabetic codes of termini correspond with mountain ranges as abbreviated in Fig. 3; the suffixes 'low' & 'high' refer to low (<1,250m) and high (>1,250m) sample data.
Fig. 2. PAE using 1 in Areas of endemism in Thailand: has historical partitioning between seasonally dry lowland and aseasonal moist mountain forests shaped biodiversity in Southeast Asia?
Fig. 2. PAE using 1° grids as OGU. Strict consensus tree of 760 equally parsimonious trees (CI = 0.501, RI = 0.557) produced by maximum parsimony analysis with unweighted 'characters' and TBR branch swapping in TNT. Symmetrical resampling support is given under the nodes (see Fig 1A for explanation of alphabetic codes).
Fig. 3 in Areas of endemism in Thailand: has historical partitioning between seasonally dry lowland and aseasonal moist mountain forests shaped biodiversity in Southeast Asia?
Fig. 3. PAE using mountain ranges as OGU. Strict consensus tree of nine equally parsimonious trees (CI = 0.745, RI = 0.722) produced by maximum parsimony analysis with weighted 'characters' and implicit enumeration in TNT. Symmetrical resampling support is given under the nodes. Abbreviations. – CM, Cardamom Mountains; DK, Dong Paya Yen – Khao Yai Forest Complex; DL, Daen Lao Range; LP, Luang Prabang Range; NST, Nakhon Si Thammarat Range; PM, Petchabun Mountains; PR, Phuket Range; PPR, Phu Pan Range; TH, Tenasserim Hills; TT, Thanon Thongchai Range. Grid-B and Grid-L refer to 1° grids (B and L in Fig. 1A) that were not assigned to any mountain range.
Fig. 1 in Areas of endemism in Thailand: has historical partitioning between seasonally dry lowland and aseasonal moist mountain forests shaped biodiversity in Southeast Asia?
Fig. 1. Maps of Thailand showing: A, Grid of 1° of latitude and longitude denoted by single-letters A–W. Mountain ranges are indicated by two- or three letter codes (CD, DK, DL, LP, NST, PM, PPR, PR, TH & TT) and the grids that comprise each range are colour-coded. Grids B and L were not assigned to any mountain range; B, Species richness (number of species) of Hybos present in 1° grids; C, reciprocal weighted endemicity of Hybos spp. calculated for 1° grids.
Fig. 1 in Two new species of the genus Brachycoraebus Kerremans and Metasambus Kerremans (Coleoptera: Buprestidae: Coraebini) from Southeast Asia
Fig. 1. Brachycoraebus aeneus, sp. nov., holotype male (a) habitus dorsal, (b) sculpture on sides of pronotum and its lateral margin, and reticulation on elytra.
Fig. 2 in Two new species of the genus Brachycoraebus Kerremans and Metasambus Kerremans (Coleoptera: Buprestidae: Coraebini) from Southeast Asia
Fig. 2. Brachycoraebus aeneus, sp. nov., paratype female, taken when still alive (Photograph by: L.F.Cheong).
Fig. 12 in Two new species of Glischrochilus with taxonomic comments, new records from Asia, and a world checklist of the genus (Coleoptera: Nitidulidae)
Fig. 12. Type locality of Glischrochilus ruzickai sp. nov. Freshly cut logs, lying on the hollow way through the secondary broadleaved forest near Tongbiguan village, Yunnan Province, China.
Figs 1–2 in Two new species of Glischrochilus with taxonomic comments, new records from Asia, and a world checklist of the genus (Coleoptera: Nitidulidae)
Figs 1–2. Dorsal habitus of Glischrochilus species. 1 – G. pilula sp. nov. (J holotype); 2 – G. ruzickai sp. nov. (♀ paratype, Myanmar).
Figures 4–7 in A new species of Coomanius Fleutiaux, 1924 (Coleoptera: Eucnemidae: Macraulacinae: Nematodini) from Southeast Asia
Figures 4–7. Coomanius badius Otto sp. nov. male holotype (BMNH). 4) Dorsal habitus. 5) Antenna. 6) Ventral habitus. 7) Aedeagus. (Scale: 5, 7 = 1.0 mm; 4, 6 = 5.0 mm.).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.