Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
6,383
datasets available to search
ShareScore release 0.9.0
Dataset results
6,383 results for “isolates”
Supplementary material 2 from: Liu QL, Chen SF (2017) Two novel species of Calonectria isolated from soil in a natural forest in China. MycoKeys 26: 25-60. https://doi.org/10.3897/mycokeys.26.14688
Phylogenetic tree of Calonectria species in the Prolate group based on maximum likelihood (ML) analysis of his3 gene sequences : Data type: molecular data
Supplementary material 1 from: Liu QL, Chen SF (2017) Two novel species of Calonectria isolated from soil in a natural forest in China. MycoKeys 26: 25-60. https://doi.org/10.3897/mycokeys.26.14688
Phylogenetic tree of Calonectria species in the Prolate group based on maximum likelihood (ML) analysis of tef1 gene sequences : Data type: molecular data
Supplementary material 5 from: Liu QL, Chen SF (2017) Two novel species of Calonectria isolated from soil in a natural forest in China. MycoKeys 26: 25-60. https://doi.org/10.3897/mycokeys.26.14688
Phylogenetic tree of Calonectria species in the Sphaero-Naviculate group based on maximum likelihood (ML) analysis of tef1 gene sequences : Data type: molecular data
Supplementary material 4 from: Liu QL, Chen SF (2017) Two novel species of Calonectria isolated from soil in a natural forest in China. MycoKeys 26: 25-60. https://doi.org/10.3897/mycokeys.26.14688
Phylogenetic tree of Calonectria species in the Prolate group based on maximum likelihood (ML) analysis of tub2 gene sequences : Data type: molecular data
Supplementary material 8 from: Liu QL, Chen SF (2017) Two novel species of Calonectria isolated from soil in a natural forest in China. MycoKeys 26: 25-60. https://doi.org/10.3897/mycokeys.26.14688
Phylogenetic tree of Calonectria species in the Sphaero-Naviculate group based on maximum likelihood (ML) analysis of tub2 gene sequences : Data type: molecular data
Supplementary material 1 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 1: Explanation note: Putative fused zoospores in isolate GE09 (A) and the similar structure reported by Orpin (1975) (B). Swollen sporangiophores and twisted rhizoids, as found in isolate GE09, were also reported for Piromyces spiralis (C, D) by Ho et al. (1993), whilst Anaeromyces (formerly Piromyces) polycephalus also forms a swollen sporangiophore (E). In older cultures of GE09, thick walled putative spore structures were frequently observed (F, G). Scalebar indicates 20 µm. A video of the putative fused zoospore is found at: https://www.youtube.com/watch?v=im14hz1jiX0.
Supplementary material 2 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 2: Explanation note: Alignment of part of the ITS1 region across a range of anaerobic fungi from all the known genera. The sequences of the modified MN100 primer used by Liggenstoffer et al. (2010) (TCCTACCCTTTGTGAATTTG) is indicated (green). For all clades except Buwchfawromyces, there is a good match for this primer. However, for members of the Buwchfawromyces, there are several mismatches at the 3' end of the primer binding site which are likely to impede PCR amplification.
Supplementary material 3 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppFig. 3: Explanation note: Intragenomic variation in ITS sequences among the five clones sequenced from isolate GE09. 18S boundary ends with GATCATTA and 5.8S begins with CAACTTT, according to the convention of Hibbett et al. (1995).
Supplementary material 4 from: Callaghan TM, Podmirseg SM, Hohlweck D, Edwards JE, Puniya AK, Dagar SS, Griffith GW (2015) Buwchfawromyces eastonii gen. nov., sp. nov.: a new anaerobic fungus (Neocallimastigomycota) isolated from buffalo faeces. MycoKeys 9: 11-28. https://doi.org/10.3897/mycokeys.9.9032
SuppTable 1: Explanation note: Details of ITS sequences falling into the Buwchfawromyces clade. The first five are all derived from the isolate GE09.
Supplementary material 1 from: Ang Y, Rajaratnam G, Su KFY, Meier R (2017) Hidden in the urban parks of New York City: Themira lohmanus, a new species of Sepsidae described based on morphology, DNA sequences, mating behavior, and reproductive isolation (Sepsidae, Diptera). ZooKeys 698: 95-111. https://doi.org/10.3897/zookeys.698.13411
Aligned COI sequences for Themira putris, T. biloba, and Themira 'biloba-like' (i.e., T. lohmanus n. sp.) specimens : Data type: Fasta file
Ectopic expression of murine CD163 enables cell-culture isolation of lactate dehydrogenase-elevating (LDV) virus 63 years after its discovery
<p><span>Arteriviruses are RNA viruses related to coronaviruses but have not yet been associated with human infection. A murine arterivirus (lactate dehydrogenase-elevating virus, LDV) was first described in 1960 and quickly became a promising model for understanding immune failure due to its unique ability to persist in immunocompetent adult mice. However, inability to culture LDV <em>in vitro</em> ultimately limited this system. Here, we demonstrate that the macrophage marker CD163 is essential for LDV infection. Expression of the murine homolog (mCD163) in otherwise mCD163-negative cell lines from mice and nonhuman primates enables productive LDV infection, creating the first immortalized cell-culture system. We also show that mCD163-knockout mice are completely resistant to LDV infection. These findings advance LDV as a model of arterivirus infection viral persistence and add to a growing body of literature suggesting that CD163 utilization is a broad feature of arteriviruses.</span></p>
Songs in Isolation VII: MOOD2020
<p>This piece was created in collaboration with Little Songs of the Mutilated, coordinated by Justin Ashworth. Around 42 individuals (from a collective of 120+ participants) submitted one sample of five seconds or less. Everyone had access to other participants' samples and tasked with creating a piece with simple guidelines: duration (3 – 15 minutes) and content (at least 90% of the sounds in the work should derive from the sample database). I used 17 of these samples, including my contribution.</p> <p>I created blocks of samples by editing and combining several samples into a block. I then used <em>GLVD</em> version four to create layers of sound by controlling the speed, pitch, and audio effects on each sample block. Takes were performed, curated, and stacked to make the final piece. I start and stop samples in this video and control the audio effects (speed, distortion, filtering, et cetera).</p> <p>The piece was composed over several months and completed in January 2021. The work was inspired by the name of one of the samples – ‘MOOD20’. I laughed at the track name at the time because I felt cranky, confined, and thoroughly sick of lockdown and the winter. As many a parent would put it, I was in a <em>mood</em>. This emotion seemed to be Melbourne's wave of public sentiment when I began writing the piece.</p> <p>Text from YouTube description box: "I'm still not sure if this is an optimistic take on 2020, or not. We spent a lot of time plodding through life, and a lot of time on zoom video calls. There were many audio glitches and spontaneous cat appearances. This video was created for the January 2021 SeenSound event. This piece was done in collaboration with the wonderful people from Little Songs of the Mutilated. Around 42 of us submitted samples of 5 seconds (or less). This piece was made with those samples, and the layers were largely created by manipulating the audio and audio effects with my GLVD glove-based gestural control system. You can see little bits of the top layers being recorded poking out through the other visuals."</p>
Wolbachia strengthens the match between pre-mating and early post-mating isolation in spider mites
Open the record for dataset details and reuse information.
Robust isolation protocol for mouse leukocytes from blood and liver resident cells for immunology research
<p>Isolation of liver and blood for single-cell RNAsequencing from mouse.</p>
Figure 10. Cyerce antillensis, radular scanning electron micrographs for isolates 10Bim01 in A cryptic radiation of Caribbean sea slugs revealed by integrative analysis: Cyerce 'antillensis' (Sacoglossa: Caliphyllidae) is six distinct species
Figure 10. Cyerce antillensis, radular scanning electron micrographs for isolates 10Bim01 (A–C) and MM109A (LACM 2004-04-9A; D, E). A, complete radula, including ascus, from isolate 10Bim01. B, leading tooth. C, close-up of ascus. D, complete radula from isolate MM109A; ascus not present. E, close-up of inset box, showing teeth on ascending limb.
Data from: The transgenerational consequences of paternal social isolation and predation exposure in threespined sticklebacks
<p>Parents routinely encounter stress in the ecological environment that can affect offspring development (transgenerational plasticity: TGP); however, parents' interactions with conspecifics may alter how parents respond to ecological stressors. During social buffering, the presence of conspecifics can reduce the response to or increase the speed of recovery from a stressor. This may have cascading effects on offspring if conspecifics can mitigate parental responses to ecological stress in ways that blunt the transmission of stress-induced transgenerational effects. Here, we simultaneously manipulated both paternal social isolation and experience with predation risk prior to fertilization in threespined stickleback (Gasterosteus aculeatus). We generated offspring via in-vitro fertilization to allow us to isolate paternal effects mediated via sperm alone (i.e., in the absence of paternal care). If social buffering mitigates TGP induced by paternal exposure to predation risk, then we expect the transgenerational effects of predation exposure to be weaker when a conspecific is present compared to when the father is isolated. Offspring of predator-exposed fathers showed reduced anxiety-like behavior and tended to be captured faster by the predator. Fathers who were socially isolated also had offspring that were captured faster by a live predator, suggesting that paternal social isolation may have maladaptive effects on how offspring respond to ecological stressors. Despite additive effects of paternal social isolation and paternal predation risk, we found no evidence of an interaction between these paternal treatments, suggesting that the presence of a conspecific did not buffer fathers and/or offspring from the effects of predation risk. Our results suggest that socially-induced stress is an important, yet underappreciated, mediator of TGP and can elicit transgenerational effects even in species that do not form permanent social groups. Future studies should therefore consider how the parental social environment can affect both within and trans-generational responses to ecological stressors.</p>
Transcriptome data of the analysis of two isolates of the tomato pathogen Cladosporium fulvum during host interaction
<p>This dataset contains sequences of assembled transcripts from isolates Race 5 and Race 4 of the tomato pathogen Cladosporium fulvum during interaction with its host.</p> <p><strong>transcripts:</strong> Assembled transcripts in FASTA and GTF fomats. The GTF files have coordinates of the transcripts in the reference genomes of isolates Race 5 (GCA_020509005.2) and Race 4 (GCA_035196885.1). The other FASTA files include the predicted open reading frames (ORFs) in the transcripts. The nucleotide coding sequence and translated amino acid sequences of the ORFs are in separated FASTA files. In the file names isolate Race 5 is indicated with '*R5*', and isolate Race 4 is indicated with '*R4*'. Description of the files is shown below:</p> <ul> <li><code>representatives_R4_diff_introns.fasta</code>: full-length transcript sequences from isolate Race 4.</li> <li><code>representatives_R5_diff_introns.fasta</code>: full-length transcript sequences from isolate Race 5.</li> <li><code>representatives_R4_diff_introns.gtf</code>: coordinates of the transcripts from isolate Race 4 in the genome of Race 4.</li> <li><code>representatives_R5_diff_introns.gtf</code>: coordinates of the transcripts from isolate Race 5 in the genome of Race 5.</li> <li><code>representatives_orfs_aa_R4_diff_introns.fasta:</code> predicted protein sequences encoded in the transcripts from isolate Race 4.</li> <li><code>representatives_orfs_aa_R5_diff_introns.fasta</code>: predicted protein sequences encoded in the transcripts from isolate Race 5.</li> <li><code>representatives_orfs_cds_R4_diff_introns.fasta</code>: predicted coding sequences in the transcripts from isolate Race 4.</li> <li><code>representatives_orfs_cds_R5_diff_introns.fasta</code>: predicted coding sequences in the transcripts from isolate Race 5.</li> </ul> <p><strong>expression:</strong> Contains tab-separated files with the expression values (transcripts per million - TPM) of the transcripts from isolates Race 5 and Race 4 at specific time points (2, 4, 6, 8, 10, 12, and 14 dpi) during interaction with tomato. TPM values were estimated with the alignment-free method Salmon.</p>
Figure 1 in An Isolated Mesoeucrocodylian Tooth Crown From The Lower Cretaceous Cerro La Isla Pterosaur Site In The Atacama Region, Northern Chile
Figure 1. Map showing the locality where SGO.PV.1160 was found; Cerro La Isla, Atacama Region, northern Chile.
Figure 2 in An Isolated Mesoeucrocodylian Tooth Crown From The Lower Cretaceous Cerro La Isla Pterosaur Site In The Atacama Region, Northern Chile
Figure 2. Mesoeucrocodylia indet. (SGO.PV.1160), in A) mesial/distal view, and B) labial/lingual view. C) shows the detail of the enamel ornamentation in a region of the crown where it is well-preserved. The white arrows point out apicobasal ridges that are present on the entire circumference of the crown.
Genome Sequence of Colletotrichum karsti isolated from rose leaves exhibiting anthracnose symptoms in Potchefstroom, South Africa.
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.