Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
5
datasets available to search
ShareScore release 0.9.0
Dataset results
5 results for “Dot plot”
Fig. 4. Dot matrix plots for ITS-1 in Molecular phylogenetics and sequence analysis of two cave-dwelling Dugesia species from Southeast Asia (Platyhelminthes: Tricladida: Dugesiidae)
Fig. 4. Dot matrix plots for ITS-1 sequences of Dugesia species. a, D. deharvengi sequence (708 bp) showing a 25 bp repeat sequence: ATACTTAAAAATGGGCGTAT(A/G)CAAT at positions 224–248, and 277–301; b, D. aethiopica sequence (616 bp) against D. sicula. Note the presence of a 30 bp repeat sequence ATGCATATTTAATAAAAGGTGTATGCATGA at positions 216–245 and 271–300.
Text-fig. 4. Macroevolutionary trends related to the IC model in the last three teeth of the six families of extinct sloths, as well as specimens of the "basal Megatherioidea", Pseudoglyptodon, and Bradypus. Dash-dot line (-.-) shows the regression including all data; solid line shows the regression after the exclusion of Octodontotherium (shown in the plot as a filled triangle). in Unexpected Inhibitory Cascade In The Molariforms Of Sloths (Folivora, Xenarthra): A Case Study In Xenarthrans Honouring Gerhard Storch'S Open-Mindedness
Text-fig. 4. Macroevolutionary trends related to the IC model in the last three teeth of the six families of extinct sloths, as well as specimens of the "basal Megatherioidea", Pseudoglyptodon, and Bradypus. Dash-dot line (-.-) shows the regression including all data; solid line shows the regression after the exclusion of Octodontotherium (shown in the plot as a filled triangle).
Pairwise distance demarcation of species in the family Coronaviridae. a, Diagonal matrix of PPDs of 2,505 viruses clustered according to 49 coronavirus species, 39 established and 10 pending or tentative, and ordered from the most to least populous species, from left to right; green and white, PPDs smaller and larger than the inter-species threshold, respectively. Areas of the green squares along the diagonal are proportional to the virus sampling of the respective species, and virus prototypes of the five most sampled species are specified to the left; asterisks indicate species that include viruses whose intra-species PPDs crossed the inter-species threshold (threshold 'violators'). b, Maximal intra-species PPDs (x axis, linear scale) plotted against virus sampling (y axis, log scale) for 49 species (green dots) of the Coronaviridae. Indicated are the acronyms of virus prototypes of the seven most sampled species. Green and blue plot sections represent intra-species and intra-subgenera PPD ranges. The vertical black line indicates the inter-species threshold. c, Shown are the PDs of non-identical residues (y axis) for four viruses representing three major phylogenetic lineages (clades) of the species Severe acute respiratorysyndrome-related coronavirus (panel b) and all pairs of the 256 viruses of this species ('all pairs'). The PD values were derived from pairwise distances in the MSA that were calculated using an identity matrix. Panels a and b were adopted from the DEmARC v.1.4 output. in The species Severe acute respiratory syndromerelated coronavirus: classifying 2019-nCoV and naming it SARS-CoV-2
Pairwise distance demarcation of species in the family Coronaviridae. a, Diagonal matrix of PPDs of 2,505 viruses clustered according to 49 coronavirus species, 39 established and 10 pending or tentative, and ordered from the most to least populous species, from left to right; green and white, PPDs smaller and larger than the inter-species threshold, respectively. Areas of the green squares along the diagonal are proportional to the virus sampling of the respective species, and virus prototypes of the five most sampled species are specified to the left; asterisks indicate species that include viruses whose intra-species PPDs crossed the inter-species threshold (threshold 'violators'). b, Maximal intra-species PPDs (x axis, linear scale) plotted against virus sampling (y axis, log scale) for 49 species (green dots) of the Coronaviridae. Indicated are the acronyms of virus prototypes of the seven most sampled species. Green and blue plot sections represent intra-species and intra-subgenera PPD ranges. The vertical black line indicates the inter-species threshold. c, Shown are the PDs of non-identical residues (y axis) for four viruses representing three major phylogenetic lineages (clades) of the species Severe acute respiratorysyndrome-related coronavirus (panel b) and all pairs of the 256 viruses of this species ('all pairs'). The PD values were derived from pairwise distances in the MSA that were calculated using an identity matrix. Panels a and b were adopted from the DEmARC v.1.4 output.
Supplementary File 8; Dot plots summarising the total frequencies of direct observations, tracks, spoor, and other signs of all wild animals detected in radial and transect surveys over the course of the study:
Open the record for dataset details and reuse information.
Text-fig. 15. Bivariate plots of upper and lower fourth premolars and third molars of Hippopotamodon erymanthius and Hippopotamodon major (stars: Luberon, dots: Pikermi and open squares: Mahmutgazi). in Hippopotamodon erymanthius (Suidae, Mammalia) from Mahmutgazi, Denizli-Çal basin, Turkey
Text-fig. 15. Bivariate plots of upper and lower fourth premolars and third molars of Hippopotamodon erymanthius and Hippopotamodon major (stars: Luberon, dots: Pikermi and open squares: Mahmutgazi).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.