Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
66
datasets available to search
ShareScore release 0.9.0
Dataset results
66 results for “comparative mitochondrial genomics”
Fig. 2 in Comparative analyses of the fragmented mitochondrial genomes of wild pig louse Haematopinus apri from China and Japan
Fig. 2. The complete mitochondrial genome of wild pig louse Haematopinus apri form China. Each minichromosome has a coding region and a non-coding region (NCR, in black). The names and transcript orientation of genes are indicated in the coding region and the minichromosomes are placed in alphabetical order of protein-coding genes and rRNA genes. Abbreviations: atp6 and atp8, ATP synthase F0 subunits 6 and 8; cytb, cytochrome b; cox1-3, cytochrome c oxidase subunits 1–3; nad1-6 and nad4L, NADH dehydrogenase subunits 1–6 and 4L; rrnS and rrnL, small and large subunits of ribosomal RNA. tRNA genes are indicated with their single-letter abbreviations of the corresponding amino acids.
Figure 3 in The complete mitochondrial genome of Lemyra melli (Daniel) (Lepidoptera: Erebidae) and a comparative analysis within the Noctuoidea
Figure 3. Putative secondary cloverleaf structures of the tRNA genes in the Lemyra melli mitogenome with mismatched bases. The blue dots, and red dots indicate Watson- Crick base pairing A-U and G-C, respectively, and the blanks indicate mismatched bases. Seven mismatches (five U-U, one A-A and one U-G) lie in five tRNA genes (three in the amino acid acceptor stems, three in the anticodon stems and one in pseudouridine (TΨC)).
Figure 1 in The complete mitochondrial genome of Lemyra melli (Daniel) (Lepidoptera: Erebidae) and a comparative analysis within the Noctuoidea
Figure 1. Map of the mitogenome of Lemyra melli. Genes lying outside and inside of the outer circle are transcribed in the counterclockwise and clockwise directions, respectively. The transfer RNA genes trnL1, trnL2, trnS1 and trnS2 are denoted trnL(UUR), trnL(CUN), trnS(AGN) and trnS(UCN), respectively. Area dashed darker gray in the inner circle denotes the GC content while the lighter gray denotes the AT content of the genome.
Figure 4 in The complete mitochondrial genome of Lemyra melli (Daniel) (Lepidoptera: Erebidae) and a comparative analysis within the Noctuoidea
Figure 4. The structure in the A+T-rich region of the Leymra melli mitogenome. The ATAGA + polyT, the duplicated 14-bp repeat element, the ATTTA + (AT)10 element, and the polyA structure are shown in the sequence.
Figure 2 in The complete mitochondrial genome of Lemyra melli (Daniel) (Lepidoptera: Erebidae) and a comparative analysis within the Noctuoidea
Figure 2. Relative Synonyous Codon Usage (RSCU) in L. melli, H. cunea, and A. formosae mitogenomes. Codons are provided on the x-axis.
Figure 6 in The complete mitochondrial genome of Lemyra melli (Daniel) (Lepidoptera: Erebidae) and a comparative analysis within the Noctuoidea
Figure 6. Phylogenetic analysis inferred from the concatenated nucleotide sequences of 13 PCGs in the mitogenome. D. melanogaster and E. regina were used as outgroups. The numbers above the branches specify bootstrap percentages (1 000 replicates) from software RAXMAL and the ML method. A, B, C, D, and E indicated the superfamily of Noctuoidea, Bombycoidea, Geometroidea, Pyraloidea and Tortricidea, respectively.
Figure 5 in The complete mitochondrial genome of Lemyra melli (Daniel) (Lepidoptera: Erebidae) and a comparative analysis within the Noctuoidea
Figure 5. The potential stem-loop structure with "GAAT" and "TATA" in the flanking region.
Comparative Mitochondrial Genomics of selected Noctuoid Moths (Lepidoptera: Noctuoidea) with implications for their Phylogeny
<p>In this study, I sequenced and annotated the complete mitochondrial genome sequences of 19 species that belong to the superfamily Noctuoidea viz. <em>Actinotia polyodon, Episparis tortuosalis, Ercheia cyllaria, Eudocima salaminia, Hulodes caranea, Hypospila bolinoides, Ischyja manlia, Lygephila dorsigera, Mecodina praecipua, Mocis undata, Odontodes seranensis, Ophiusa tirhaca, Oraesia emarginata, Pandesma quenavadi, Polydesma boarmoides, Psimada quadripennis, Rusicada privata, Trigonodes hyppasia </em>and<em> Xanthodes albago</em>. In addition to this, I performed the analysis of their genetic compositions as well as their molecular characterization in order to provide molecular insights into their taxonomic and phylogenetic implications. Based on the data and those obtained from the NCBI database, I examined the phylogenetic relationships among the species of the superfamily Noctuoidea.</p>
Data from: Comparative phylogeography of trans-Andean freshwater fishes based on genome-wide nuclear and mitochondrial markers
Open the record for dataset details and reuse information.
FIGURE 4 in Comparative mitochondrial genomics of Shoveliteratura triangula (Orthoptera Tettigoniidae, Meconematinae) and the first description of a female specimen
FIGURE 4. Phylogenetic reconstruction of the Meconematinae using mitochondrial PCGs and rRNA of the concatenated dataset. Applicable posterior probability values are shown. Numbers in the ML tree represent SH-aLRT support/ultrafast bootstrap support values.
FIGURE 2 in Comparative mitochondrial genomics of Shoveliteratura triangula (Orthoptera Tettigoniidae, Meconematinae) and the first description of a female specimen
FIGURE 2. Relative synonymous codon usage of Shoveliteratura triangula mitochondrial protein-coding genes. Codon families are shown on the x-axis.
Data from: The first complete mitochondrial genome of the Indian Tent Turtle, Pangshura tentoria (Testudines: Geoemydidae): characterization and comparative analysis
Characterization of complete mitogenome is a widely used genomics study for species delineation and evolutionary research. However, the sequences and structural motifs contained within the mitogenome have been rarely examined to understand the phylogeny and evolutionary history among Testudines. Hence, the mitogenomic features of several Testudines taxa are still anonymous to the scientific communities. The present study decodes the first complete mitochondrial genome of the Indian Tent Turtle, Pangshura tentoria (16,657 bp) by using next-generation sequencing. This denovo assembly encodes 37 genes: 13 protein coding genes (PCGs), 22 transfer RNA (tRNAs), two ribosomal RNA (rRNAs), and one control region (CR). The mitogenome contained 19 intergenic spacer and six overlapping regions. Most of the genes were encoded on majority strand, except for one PCG (NADH dehydrogenase subunit 6) and eight tRNAs. Most of the PCGs were started with an ATG initiation codon, except for cytochrome oxidase subunit 1 with 'GTG' and NADH dehydrogenase subunit 5 with 'ATA'. The termination codons, 'TAA' and 'AGA' were observed in NADH dehydrogenase subunit 4l and NADH dehydrogenase subunit 6 respectively. The Relative Synonymous Codon Usage analysis revealed the maximum abundance of Alanine, Isoleucine, Leucine, and Threonine. The non-synonymous/synonymous ratios were <1 in all PCGs, which indicates strong negative selection among all Geoemydid species. The study also found the typical cloverleaf secondary structure in most of the tRNA genes, except for Serine (trnS1) with lack of the conventional DHU arm. The Wobble base pairing was observed in the different stems (DHU, acceptor, and anticodon) of 11 tRNAs. The comparative study of Geoemydid mitogenomes revealed the occurrence of tandem repeats was frequent in the 3´ end of CR. Further, two copies of a unique tandem repeat 'TTCTCTTT' were identified in P. tentoria. The Bayesian and Maximum Likelihood phylogenetic trees using concatenation of 13 PCGs revealed the close relationships of P. tentoria with Batagur trivittata in the studied dataset. All the Geoemydid species showed distinct clustering with high bootstrap support congruent with previous evolutionary hypotheses. We suggest that the generations of more mitogenomes of Geoemydid species, especially for Batagurinae subfamily, are required to improve our understanding their in-depth phylogenetic and evolutionary relationships.
FIGURE 8 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 8. Tree showing the phylogenetic relationships among Lepidoptera species, constructed using Maximum Likelihood method. Bootstrap values (1000 repetitions) of the branches are indicated. Drosophila incompta (NC_025936) and Anopheles gambiae (NC_002084) were used as outgroups.
FIGURE 7 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 7. Features present in the A+T-rich region of Smerinthus planus. The ATATG motif is yellow shaded. The poly-T stretch is dotted underlined while the poly-A stretch is underlined. The single microsatellite T/A repeat sequence is indicated by gray shaded.
FIGURE 5 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 5. Putative secondary structures of the 22 tRNA genes of the Smerinthus planus mitochondrial genome.
FIGURE 6 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 6. Sequence alignment of PCG and tRNA regions from 27 different Lepidoptera species. 6A, The color sequence part is motif AAGATAGAAACCAACCTGGCTYACACCGGTTTGAACTCAGATCATGTAAG; 6B, The color sequence part is motif GAAGAATGAACTAAAGCAGAAACWGGAGTWGGAGCWGCTATAGCWGCWGG; 6C, The color sequence part is motif AAYCCWGAAACTAATTCTCTTTCHCCTTCAGCAAAATCAAAAGGAGTWCG.
FIGURE 4. A in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 4. A. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of 31 species in the Lepidoptera. Codon families are plotted on the X axis. B. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of S. planus in the Lepidoptera. Codon families are plotted on the X axis.
FIGURE 2 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 2. Comparison of the codon usage patterns within the mitochondrial genome of different Lepidoptera species.
FIGURE 3 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 3. Codon distribution patterns in various Lepidoptera species. The y-coordinate is the proportion of codons per 100 codons.
FIGURE 1 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 1. Map of the mitogenome of S. planus. The tRNA genes are labeled according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 refer to the cytochrome c oxidase subunits; cob refers to cytochrome b; nad1-nad6 refer to NADH dehydrogenase components; rrnL and rrnS refer to ribosomal RNAs. Gene named above the bar are located on major strand, while the others are located on minor strand.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.