Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
22
datasets available to search
ShareScore release 0.9.0
Dataset results
22 results for “trnl”
rCRUX Generated Taberlet c/h trnl Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: Taberlet c/h trnl<br> Gene: trnl<br> Length of Target: 150<br> get_seeds_local() minimum length: 105<br> get_seeds_local() maximum length: 150<br> blast_seeds() minimum length: 85<br> blast_seeds() maximum length: 128<br> max_to_blast: 100<br> Forward Sequence (5'-3'): CGAAATCGGTAGACGCTACG<br> Reverse Sequence (5'-3'): CCATTGAGTCTCTGCACCTATC<br> Reference: Taberlet, P., Gielly, L., Pautou, G., & Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of. Plant molecular biology, 17, 1105-1109. & Taberlet, Pierre, Eric Coissac, François Pompanon, Ludovic Gielly, Christian Miquel, Alice Valentini, Thierry Vermat, Gerard Corthier, Christian Brochmann, and Eske Willerslev. "Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding." Nucleic acids research 35, no. 3 (2007): e14-e14.</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
rCRUX Generated trnl plants Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: trnl plants<br> Gene: trnl<br> Length of Target: ~85<br> get_seeds_local() minimum length: 60<br> get_seeds_local() maximum length: 110<br> blast_seeds() minimum length: 23<br> blast_seeds() maximum length: 73<br> max_to_blast: 250<br> Forward Sequence (5'-3'): GGGCAATCCTGAGCCAA<br> Reverse Sequence (5'-3'): TTTGAGTCTCTGCACCTATC<br> Reference: Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... & Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007). https://doi.org/10.1093%2Fnar%2Fgkl938</p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Data from: Assessment of the food habits of the Moroccan dorcas gazelle in M'Sabih Talaa, West central Morocco, using the trnL approach
Food habits of the Moroccan dorcas gazelle, Gazella dorcas massaesyla, previously investigated in the 1980s using microhistological fecal analysis, in the M'Sabih Talaa reserve west central Morocco, were re-evaluated over three seasons (spring, summer and autumn 2009) using the trnL approach to determine the diet composition and its seasonal variation from fecal samples. Taxonomic identification was carried out using the identification originating from the database built from EMBL and the list of plant species within the reserve. The total taxonomic richness in the reserve was 130 instead of 171 species in the 1980s. The diet composition revealed to be much more diversified (71 plant taxa belonging to 57 genus and 29 families) than it was 22 years ago (29 identified taxa). Thirty four taxa were newly identified in the diet while 13 reported in 1986-87 were not found. Moroccan dorcas gazelle showed a high preference to Acacia gummifera, Anagallis arvensis, Glebionis coronaria, Cladanthus arabicus, Diplotaxis tenuisiliqua, Erodium salzmannii, Limonium thouini, Lotus arenarius and Zizyphus lotus. Seasonal variations occurred in both number (40-41 taxa in spring-summer and 49 taxa in autumn vs. respectively 23-22 and 26 in 1986-1987) and taxonomic type of eaten plant taxa. This dietary diversification could be attributed either to the difference in methods of analysis, trnL approach having a higher taxonomic resolution, or a potential change in nutritional quality of plants over time.
Data from: Phylogenetic relationships of Iranian Allium sect. Allium (Amaryllidaceae, Allioideae) as inferred from nrDNA ITS, cpDNA rps16 and trnL–F sequences
Allium is a particularly species rich (more than 800 species) and economically important genus, with numerous taxonomic problems at all levels of classification. In this study, we try to uncover the phylogenetic relationships in the common leek (A. ampeloprasum) based on selected samples of this species and its putative relatives in sect. Allium from Iran. The silica-dried leaf samples of 56 accessions representing 23 species of Allium were sequenced for this study, 53 sequences of nrDNA ITS, 35 sequences of plastid rps16 and 52 sequences of trnL-F were generated and several accessions were extracted from GenBank in order to cover all recognized main lineages in the genus. Maximum Parsimony and Bayesian Inference generated similar trees, but the placement of A. ampeloprasum and its relatives differs slightly in the nuclear versus plastid datasets. In the nrITS tree A. ampeloprasum is retrieved in a highly supported clade with A. iranicum, while in the combined plastid tree A. ampeloprasum formed a highly supported clade with A. vineale. This supports the hypothesis of a possible hybrid origin of A. ampeloprasum. Allium iranicum formed a clade in the plastid tree, but was resolved as paraphyletic in the nrITS tree, probably due to presence of multiple non-concerted copies of nrITS. Close relationships are suggested between following species: A. aznavense and A. wendelboi with A. talyschense, A. erubescens and A. rotundum with A. scorodoprasum, and A. abbasii with A. phanerantherum.
FIGURE. Bayesian tree based on combined plastid (matK, trnL-trnF) sequence data showing phylogenetic position of Hedysarum sunhangii sp. nov. in Subsect. Crinifera. Bayesian posterior probability (PP) / maximum parsimony (MP) are given on each branch, respectively; maximum likelihood (ML) is below branches in Hedysarum sunhangii (Fabaceae, Hedysareae), a new species from Pamir-Alay (Babatag Ridge - Uzbekistan)
FIGURE. Bayesian tree based on combined plastid (matK, trnL-trnF) sequence data showing phylogenetic position of Hedysarum sunhangii sp. nov. in Subsect. Crinifera. Bayesian posterior probability (PP) / maximum parsimony (MP) are given on each branch, respectively; maximum likelihood (ML) is below branches
FIGURE 1. Combined trnL-F, rpl16 in Lifeforms as criterion for species delimitation: Are Aristida adscensionis and A. coerulescens (Aristidoideae, Poaceae) two species?
FIGURE 1. Combined trnL-F, rpl16 intron and nrITS ML tree of the Aristida adscensionis group. Numbers behind taxon names refer to Table 1 and geographical origins of each accession is given. The first number along a branches indicates PP, and the second number BS>50%. A. = Aristida.
FIGURE 7. The trnL-F in Semiaquilegia danxiashanensis (Ranunculaceae), a new species from Danxia Shan in Guangdong, southern China
FIGURE 7. The trnL-F maximum likelihood phylogenetic trees with BI posterior probability/ML bootstrap support values (>0.5 or 50%) shown below and above the branch around the corresponding node. The accessions of Semiaquilegia danxiashanensis are highlighted in bold.
FIGURE 1 in A partial cpDNA trnL sequence from the extinct legume Streblorrhiza speciosa confirms its placement in the tribe Coluteae (Fabaceae)
FIGURE 1. Bayesian maximum clade credibility tree showing the relationship of Streblorrhiza to other members of the tribe Coluteae. Posterior probability values are indicated above the branches.
FIGURE 2. Bayesian majority rule consensus tree inferred from the plastid DNA trnL-F in Evolutionary history of the tribe Astereae in the Flora Iranica area: Systematic implications
FIGURE 2. Bayesian majority rule consensus tree inferred from the plastid DNA trnL-F dataset. Numbers abovebranches are posterior probability (PP) and likelihood as well as parsimony bootstrap (BS) values, respectively. Values>50 % are shown.
FIGURE 4. Phylogenetic tree with bootstrap values inferred from trnL-F in Revisit of European-Asiatic connections in Tayloria rudolphiana (Splachnaceae, Bryophyta) based on molecular data and new morphological evidence
FIGURE 4. Phylogenetic tree with bootstrap values inferred from trnL-F sequences (accession numbers after each species name obtained from Genbank) based on Maximum Likelihood and Maximum Parsimony analyses. Values above the branches indicate bootstrap (>50%) and numbers below the branches indicate PP values of Bayesian.
FIGURE 2. The Bayesian phylogenetic tree from trnL-F in Primulina cataractarum sp. nov. (Gesneriaceae) from limestone landform in Southern Hunan, China
FIGURE 2. The Bayesian phylogenetic tree from trnL-F sequence data with BI posterior probability/MP bootstrap support values (>0.5 or 50%) shown above and below the corresponding branches. * indicates the new species.
FIGURE. Median network analyses (MNA) of a subset of the C. trilobus aggregate (i.e. those in the clade A from Fig. 11) based on concatenated DNA sequence data from ITS, trnL-trnF and psbJ-petA. Stars and arrow indicate accessions discussed in the text. NI: North Island, SI: South Island. in Five new species of Corybas (Diurideae, Orchidaceae) endemic to New Zealand and phylogeny of the Nematoceras clade
FIGURE. Median network analyses (MNA) of a subset of the C. trilobus aggregate (i.e. those in the clade A from Fig. 11) based on concatenated DNA sequence data from ITS, trnL-trnF and psbJ-petA. Stars and arrow indicate accessions discussed in the text. NI: North Island, SI: South Island.
FIGURE. Bayesian tree of New Zealand spider orchids (Corybas) based on DNA sequence data from ITS, trnL-trnF and psbJ-petA. Major clades are indicated by open bars and capital letters, members of the C. trilobus aggregate are shaded, and posterior probabilities/ bootstrap percentages (≥50) indicated by numbers near each node. NI: North Island, SI: South Island, MCQI: Macquarie Island, CHI: Chatham Island in Five new species of Corybas (Diurideae, Orchidaceae) endemic to New Zealand and phylogeny of the Nematoceras clade
FIGURE. Bayesian tree of New Zealand spider orchids (Corybas) based on DNA sequence data from ITS, trnL-trnF and psbJ-petA. Major clades are indicated by open bars and capital letters, members of the C. trilobus aggregate are shaded, and posterior probabilities/ bootstrap percentages (≥50) indicated by numbers near each node. NI: North Island, SI: South Island, MCQI: Macquarie Island, CHI: Chatham Island
FIGURE 6. The maximum likehood tree generated using cpDNA trnL-F in A new species of Hedysarum (Fabaceae) from Turkey
FIGURE 6. The maximum likehood tree generated using cpDNA trnL-F sequences and outgroups sequences retrieved from NCBI (Bootstrap values are given above branches).
FIG. 2 in A Molecular Systematic Study of the Lampranthus Group (Aizoaceae) Based on the Chloroplast TrnL-trnF and Nuclear ITS and 5S NTS Sequence Data
FIG. 2. Strict consensus tree of the 30,000 most parsimonious trees based on the combined trnL-F, ITS and 5S spacer sequence data recovered during simultaneous analysis 1 (not weighted) including 58 taxa; Length = 524, CI = 0.479, RI = 0.601, RC = 0.288. Values above the internodes give the jackknife values. Members of the Lampranthus group are underlined.
FIG. 1 in A Molecular Systematic Study of the Lampranthus Group (Aizoaceae) Based on the Chloroplast TrnL-trnF and Nuclear ITS and 5S NTS Sequence Data
FIG. 1. Strict consensus tree of the 30,000 most parsimonious trees based on the 5S spacer sequence data recoverd during heuristic Search 3 for 56 taxa; Length = 231, CI = 0.519, RI = 0.743, RC = 0.386. Values above the internodes give the jackknife values (where absent, the jackknife values are less than 50%). Members of the Lampranthus group are underlined.
FIG. 3 in A Molecular Systematic Study of the Lampranthus Group (Aizoaceae) Based on the Chloroplast TrnL-trnF and Nuclear ITS and 5S NTS Sequence Data
FIG. 3. Strict consensus tree of the 167 most parsimonious trees based on the combined and successively weighted trnL-F, ITS and 5S spacer sequence data recovered during simultaneous analysis 4 including 51 taxa; CI = 0.599, RI = 0.841, RC = 0.504. Values above the internodes give the jackknife values. Members of the Lampranthus group are underlined.
Data from: Phylogenetic relationships of Iranian Allium sect. Allium (Amaryllidaceae, Allioideae) as inferred from nrDNA ITS, cpDNA rps16 and trnL–F sequences
Open the record for dataset details and reuse information.
Data from: Assessment of the food habits of the Moroccan dorcas gazelle in M’Sabih Talaa, West central Morocco, using the trnL approach
Open the record for dataset details and reuse information.
Sequence alignment of Stizophyllum for the markers: Ndhf, rpl32-trnl and pepc
Open the record for dataset details and reuse information.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.