Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
2,315
datasets available to search
ShareScore release 0.9.0
Dataset results
2,315 results for “Comparative analysis”
Comparative gene expression analysis reveals mechanism of Pinus contorta response to the fungal pathogen Dothistroma septosporum
<p>Many conifers have distributions that span wide ranges in both biotic and abiotic conditions, but the basis of response to biotic stress has received much less attention than response to abiotic stress. In this study,<span> w</span>e investigated the gene expression response of lodgepole pine (<i>Pinus contorta</i>) to attack by the fungal pathogen <i>Dothistroma septosporum</i>, which causes <i>Dothistroma </i>needle blight (DNB), a disease that has caused severe climate-related outbreaks in northwestern British Columbia. We inoculated tolerant and susceptible pines with two <i>D. septosporum</i> isolates and analyzed the differentially expressed genes, differential exon usage, and co-expressed gene modules using RNA-seq data. We found a rapid and strong transcriptomic response in tolerant lodgepole pine samples inoculated with one <i>D. septosporum</i> isolate, and a late and weak response in susceptible samples inoculated with another isolate. We mapped 43 of the DEG- or gene-module-identified genes to the reference plant-pathogen interaction pathway deposited in KEGG database. These genes are present in PAMP-triggered and effector-triggered immunity pathways, including genes encoding mitogen-activated protein kinase and disease resistance protein. Genes comprising pathways and gene modules had signatures of strong selective constraint, while the highly expressed genes in tolerant samples appear to have been favored by selection to counterattack the pathogen. We identified candidate resistance genes that may respond to <i>D. septosporum</i> effectors. Taken together, our results show that gene expression response to <i>D. septosporum</i> infection in lodgepole pine varies both among tree genotypes and pathogen strains, and involves both known candidate genes and a number of genes with previously unknown functions.</p>
FIGURE 5 in Comparative analysis of the chondrocranium and hyobranchial skeleton of bromeliad arboreal frog larvae of the genus Phyllodytes Wagler, 1830 (Anura Hylidae)
FIGURE 5. Hyobranchial skeleton. Ventral views for Phyllodytes acuminatus (A, Stage 31, MHN–UFAL 8385), P. brevirostris (B, Stage 34, MNRJ 53 122), P. edelmoi (C, Stage 36, MHN–UFAL 3768), P. maculosus (D, Stage 27, CZUFSB 509), P. melanomystax (E, Stage 28, MNRJ 04 868), P. praeceptor (F, Stage 31, MZUESC 16 059), P. punctatus (G, Stage 29, LABEV–UFS 1167), P. wuchereri (H, Stage 31, CLAR 9492), Phyllodytes sp. 5 (I, Stage 36, MHNBA 15 996). (ac) articular condyle; (bbc) basibranchial; (bh) basihyal; (cb I–IV) ceratobranchials; (ch) ceratohyal; (hbp) hypobranchial plate; (pab) processus anterior branchialis; (pac) processus anterior hyalis; (palc) processus anterolateralis hyalis; (plc) processus lateralis hyali; (ppc) processus posterior hyalis; (pr) pars reuniens; (sp) spicules; (tco) terminal commissure; (up) urobranchial process (scale bars =1 mm).
FIGURE 3 in Comparative analysis of the chondrocranium and hyobranchial skeleton of bromeliad arboreal frog larvae of the genus Phyllodytes Wagler, 1830 (Anura Hylidae)
FIGURE 3. Suprarostral cartilage of P. melanomystax (Stage 28, MNRJ 04 868), frontal view. (a) ala; (c) corpus; (ppd) processus posterior dorsalis (scale bar =1 mm).
FIGURE 4 in Comparative analysis of the chondrocranium and hyobranchial skeleton of bromeliad arboreal frog larvae of the genus Phyllodytes Wagler, 1830 (Anura Hylidae)
FIGURE 4. Chondrocranium. Lateral views for Phyllodytes acuminatus (A, Stage 31, MHN–UFAL 8385), P. brevirostris (B, Stage 34, MNRJ 53 122), P. edelmoi (C, Stage 36, MHN–UFAL 3768), P. maculosus (D, Stage 27, CZUFSB 509), P. melanomystax (E, Stage 28, MNRJ 04 868), P. praeceptor (F, Stage 31, MZUESC 16 059), P. punctatus (G, Stage 29, LABEV–UFS 1167), P. wuchereri (H, Stage 31, CLAR 9492), Phyllodytes sp. 5 (I, Stage 36, MHNBA 15 996). (bc) braincase; (fov) fenestra ovalis; (mc) Meckel's cartilage; (mp) muscular process; (oc) otic capsule; (ocf) oculomotor foramen; (opf) optic foramen; (orc) orbital cartilage; (pq) palatoquadrate; (plt) processus lateralis trabeculae; (sc) suprarostral cartilage; (th) trabecular horns; (trf) trochlear foramen (scale bars =1 mm).
FIGURE 2 in Comparative analysis of the chondrocranium and hyobranchial skeleton of bromeliad arboreal frog larvae of the genus Phyllodytes Wagler, 1830 (Anura Hylidae)
FIGURE 2. Chondrocranium. Ventral views for Phyllodytes acuminatus (A, Stage 31, MHN–UFAL 8385), P. brevirostris (B, Stage 34, MNRJ 53 122), P. edelmoi (C, Stage 36, MHN–UFAL 3768), P. maculosus (D, Stage 27, CZUFSB 509), P. melanomystax (E, Stage 28, MNRJ 04 868), P. praeceptor (F, Stage 31, MZUESC 16 059), P. punctatus (G, Stage 29, LABEV–UFS 1167), P. wuchereri (H, Stage 31, CLAR 9492), Phyllodytes sp. 5 (I, Stage 36, MHNBA 15 996). (cf) carotid foramen; (crf) craniopalatine foramen; (ic) infrarostral cartilage; (jf) jugulare foramen; (pf) perilymphaticum foramen; (pr) retroarticular process of Meckel's cartilage; (qcc) quadratocranial commissure (scale bars =1 mm).
FIGURE 1 in Comparative analysis of the chondrocranium and hyobranchial skeleton of bromeliad arboreal frog larvae of the genus Phyllodytes Wagler, 1830 (Anura Hylidae)
FIGURE 1. Chondrocranium. Dorsal views for Phyllodytes acuminatus (A, Stage 31, MHN–UFAL 8385), P. brevirostris (B, Stage 34, MNRJ 53 122), P. edelmoi (C, Stage 36, MHN–UFAL 3768), P. maculosus (D, Stage 27, CZUFSB 509), P. melanomystax (E, Stage 28, MNRJ 04 868), P. praeceptor (F, Stage 31, MZUESC 16 059), P. punctatus (G, Stage 29, LABEV–UFS 1167), P. wuchereri (H, Stage 31, CLAR 9492), Phyllodytes sp. 5 (I, Stage 36, MHNBA 15 996). (a) ala; (as) ascending process; (bf) basicranial fenestra; (c) corpus; (ep) ethmoid plate; (mc) Meckel's cartilage; (mp) muscular process; (oc) otic capsule; (op) larval otic process; (plp) posterolateral process; (pq) palatoquadrate; (paq) articular process of palatoquadrate; (qep) quadratoethmoid process; (sf) subocular fenestra; (st) synotic tectum; (th) trabecular horns (scale bars =1 mm).
Comparative analysis of genetic and morphological variation within the Platanthera hyperborea complex (Orchidaceae)
<p>Species complexes present considerable problems for a working taxonomy due to the presence of intraspecific variation, hybridization, polyploidy, and phenotypic plasticity. Understanding evolutionary patterns using molecular markers can allow for a more thorough assessment of evolutionary lineages than traditional morphological markers. In this study, we evaluated genetic diversity and phylogenetic patterns among taxa of the <i>Platanthera hyperborea </i>(Orchidaceae) complex, which includes diploid (<i>Platanthera aquilonis</i>) and polyploid (<i>Platanthera hyperborea</i>,<i> P. huronensis</i>,<i> P. convallariifolia) </i>taxa spanning North America, Greenland, Iceland, and Asia. We found that three floral morphological characters overlap among the polyploid taxa, but the diploid species has smaller flowers. DNA sequence variation in a plastid (<i>rpL16</i> intron) and a nuclear (ITS) marker indicated that at least three diploid species have contributed to the genomes of the polyploid taxa, suggesting all are of allopolyploid origin. <i>Platanthera convallariifolia </i>is most like <i>P. dilatata </i>and <i>P. stricta</i>,<i> </i>whereas <i>P. huronensis </i>and <i>P. hyperborea </i>appear to have originated from crosses of <i>P. dilatata </i>and <i>P. aquilonis</i>. <i>Platanthera huronensis</i>,<i> </i>which is found across North America, has multiple origins and reciprocal maternal parentage from the diploid species. By contrast, <i>P. hyperborea</i>,<i> </i>restricted to Greenland and Iceland, appears to have originated from a small founding population of hybrids in which <i>P. dilatata </i>was the maternal parent. Geographic structure was found among polyploid forms in North America. The area of Manitoba, Canada appears to be a contact zone among geographically diverse forms from eastern and western North America. Given the geographic and genetic variation found, we recommend continued recognition of four green-flowered species within this complex, but caution that there may be additional cryptic taxa within North America.</p>
FIGURE 1 in Description of the first zoeal stage of Synalpheus apioceros Coutière, 1909 (Caridea Alpheidae), including a comparative analysis with larval morphology from the genus Synalpheus Spence Bate, 1888
FIGURE 1. Synalpheus apioceros Coutière, 1909, Zoea I. a. Dorsal view; b. Lateral view; c. Antennule; d. Antenna; e. Maxillule; f. Maxilla; g–i. First–third maxillipeds; j–n. Pereiopods I–V; o. Telson. (Scale bars: a, b = 0.2 mm; c, h, j, k, l, m, n, o = 0.1 mm; d, g, i = 0.05 mm; e, f = 0.02mm).
FIGURE 8 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 8. Tree showing the phylogenetic relationships among Lepidoptera species, constructed using Maximum Likelihood method. Bootstrap values (1000 repetitions) of the branches are indicated. Drosophila incompta (NC_025936) and Anopheles gambiae (NC_002084) were used as outgroups.
FIGURE 7 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 7. Features present in the A+T-rich region of Smerinthus planus. The ATATG motif is yellow shaded. The poly-T stretch is dotted underlined while the poly-A stretch is underlined. The single microsatellite T/A repeat sequence is indicated by gray shaded.
FIGURE 5 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 5. Putative secondary structures of the 22 tRNA genes of the Smerinthus planus mitochondrial genome.
FIGURE 6 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 6. Sequence alignment of PCG and tRNA regions from 27 different Lepidoptera species. 6A, The color sequence part is motif AAGATAGAAACCAACCTGGCTYACACCGGTTTGAACTCAGATCATGTAAG; 6B, The color sequence part is motif GAAGAATGAACTAAAGCAGAAACWGGAGTWGGAGCWGCTATAGCWGCWGG; 6C, The color sequence part is motif AAYCCWGAAACTAATTCTCTTTCHCCTTCAGCAAAATCAAAAGGAGTWCG.
FIGURE 4. A in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 4. A. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of 31 species in the Lepidoptera. Codon families are plotted on the X axis. B. The Relative Synonymous Codon Usage (RSCU) of the mitochondrial genome of S. planus in the Lepidoptera. Codon families are plotted on the X axis.
FIGURE 2 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 2. Comparison of the codon usage patterns within the mitochondrial genome of different Lepidoptera species.
FIGURE 3 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 3. Codon distribution patterns in various Lepidoptera species. The y-coordinate is the proportion of codons per 100 codons.
FIGURE 1 in The mitochondrial genome of Smerinthus planus (Lepidoptera: Sphingidae) and its comparative analysis with other Lepidoptera species
FIGURE 1. Map of the mitogenome of S. planus. The tRNA genes are labeled according to the IUPAC-IUB single-letter amino acids: cox1, cox2 and cox3 refer to the cytochrome c oxidase subunits; cob refers to cytochrome b; nad1-nad6 refer to NADH dehydrogenase components; rrnL and rrnS refer to ribosomal RNAs. Gene named above the bar are located on major strand, while the others are located on minor strand.
A Comparative Analysis of Temporal Long Text Similarity: Application to Financial Documents
<p>Textual Similarity on MD&A disclosure</p>
Comparative analysis of angiogenesis models: MATLAB data files
<p>This data set contains the MATLAB files that were used to generate figures located in the article "Comparative analysis of angiogenesis models" (J. Math. Biol, in press). The article's abstract may be found below. </p> <p>Although discrete approaches are increasingly employed to model biological phenomena, it remains unclear how complex, population-level behaviours in such frameworks arise from the rules used to represent interactions between individuals. Discrete-to-continuum approaches, which are used to derive systems of coarse-grained equations describing the mean-field dynamics of a microscopic model, can provide insight into such emergent behaviour. Coarse-grained models often contain nonlinear terms that depend on the microscopic rules of the discrete framework, however, and such nonlinearities can make a model difficult to mathematically analyse. By contrast, models developed using phenomenological approaches are typically easier to investigate but have a more obscure connection to the underlying microscopic system. To our knowledge, there has been little work done to compare solutions of phenomenological and coarse-grained models. Here we address this problem in the context of angiogenesis (the creation of new blood vessels from existing vasculature). We compare asymptotic solutions of a classical, phenomenological "snail-trail" model for angiogenesis to solutions of a nonlinear system of partial differential equations (PDEs) derived via a systematic coarse-graining procedure (Pillay, 2017). For distinguished parameter regimes corresponding to chemotaxis-dominated cell movement and low branching rates, both continuum models reduce at leading order to identical PDEs within the domain interior. Numerical and analytical results confirm that pointwise differences between solutions to the two continuum models are small if these conditions hold, and demonstrate how perturbation methods can be used to determine when a phenomenological model provides a good approximation to a more detailed coarse-grained system for the same biological process.</p>
Data from: Comparative analysis of DNA extraction methods to study the body surface microbiota of insects: a case study with ant cuticular bacteria
High-throughput sequencing of the 16S rRNA gene has considerably helped revealing the essential role of bacteria living on insect cuticles in the ecophysiology and behavior of their hosts. However, our understanding of host-cuticular microbiota feedbacks remains hampered by the difficulties to working with low bacterial DNA quantities as in individual insect cuticle samples, which are more prone to molecular biases and contaminations. Herein, we conducted a methodological benchmark on the cuticular bacterial loads retrieved from two Neotropical ant species of different body size and ecology: Atta cephalotes (~15 mm) and Pseudomyrmex penetrator (~5 mm). We evaluated the richness and composition of the cuticular microbiota, as well as the amount of biases and contamination produced by four DNA extraction protocols. We also addressed how bacterial communities' characteristics would be affected by the number of individuals or individual body size used for DNA extraction. Most extraction methods yielded similar results in term of bacterial diversity and composition for A. cephalotes (~15 mm). In contrast, greater amounts of artifactual sequences and contaminations, as well as noticeable differences in bacterial communities' characteristics were observed between the extraction methods for P. penetrator (~5 mm). We also found that large (~15 mm) and small (~5 mm) A. cephalotes individuals harbor different bacterial communities. Our benchmark hence suggests that cuticular microbiota of single insect individuals can be reliably retrieved provided that blank controls, appropriate data cleaning, and standardization of individual body size are considered in the experiment.
Scripts and raw data for comparing 2D vs 3D image analysis of zebrafish embryo microscopic data
<p>Raw data and MatLab scripts used for image analysis of RNA polymerase II with serine 5 phosphorylation in the C-terminal domain (CTD) of the subunit 1 (Pol II Ser5P) in a fixed zebrafish embryo, comparing a 2D vs 3D approach to segment out the Pol II Ser5P clusters. Pol II Ser5P was labeled by immunofluorescence, microscopy images were acquired by instant-SIM microscopy and analyzed using MatLab scripts and the bioformats importer.</p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.