Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
3,696
datasets available to search
ShareScore release 0.9.0
Dataset results
3,696 results for “Reference”
Fig. 43. Character 65. Uncal aedeagal restraint, states 0–3 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 43. Character 65. Uncal aedeagal restraint, states 0–3: (0) by tubular encapsulation on ventral surface of uncus; (1) by membrane prior to ventral surface of uncus; (2) by claspers; (3) by apical slit in uncus.
Fig. 46. Character 67 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 46. Character 67. Aedeagus basal plate in lateral view, states 0–4: (0) right-angled at distal end; (1) undulated, weakly depressed on dorsal midline; (2) sharply turned through more than 90°; (3) downturned at distal end; (4) basally very narrow becoming broad apically.
Fig. 36. Character 33. Hind wing anal lobe, states 0 and 1 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 36. Character 33. Hind wing anal lobe, states 0 and 1: (0) broad with vein 3A usually strongly curved at distal end, long and separated from wing margin; (1) narrow with vein 3A tending straight, short and usually adjacent to wing margin.
Fig. 33. Character 22. Fore wing veins M in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 33. Character 22. Fore wing veins M and CuA, states 0–4: (0) unfused and widely separated at basal cell; (1) unfused but CuA and M very much closer than CuA is to CuP+1A, with basal cell very elongate; (2) meeting at basal cell but veins not aligned; (3) meeting at basal cell with vein aligned after basal cell but not fused; (4) meeting basal cell with their stems completely fused.
Fig. 37. Character 38. Male opercula development, states 0–9 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 37. Character 38. Male opercula development, states 0–9: (0) more or less confluent with distal margin of tympanal cavity, well developed towards abdominal midline with sharply rounded apices facing midline, clearly separated; (1) more or less reaching margin of tympanal cavity (rarely beyond), directed towards distomedial margin of tympanal cavity, apically broadly rounded, not meeting; (2) covering rim of distal margin of tympanal cavity, overlapping; (3) distant from lateral margin of tympanal cavity, directed towards distomedial margin of tympanal cavity, apically tapering to a blunt point, inner margin straight, clearly not meeting; (4) tending linear, both outer and inner margins straight or nearly so, distal margin broadly rounded, distally expanded towards midline, reaching distal margin of tympanal cavity or beyond, not meeting; (5) reaching far beyond tympanal cavity to cover some 2⁄ length of abdomen, 3 clearly separated; (6) completely covering tympanal cavity, completely encapsulating meracanthus, not overlapping; (7) nearly triangular, strongly cupped, covering and extending beyond tympanal cavity, completely encapsulating meracanthus, not meeting; (8) narrow, tending parallel-sided, lacking a distinct lateral angle, development towards abdominal midline, short of distal margin of tympanal cavity, far from meeting; (9) lateral margin arising considerably indented from basal extremity, partly encapsulating meracanthus, distal margin nearly straight, never closing tympanal cavity.
Fig. 31 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 31. Development of family and subfamily concepts for the Cicadoidea from the time of Distant's catalogue (1906b) to the most recently proposed classification (Boulard, 1998); modified from Hayashi (1984).
Figs. 29–30 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Figs. 29–30. Female reproductive system, Arunta perulata, Cicadinae: (Fig. 29) partial dissection, lateral view, nearside abdominal sclerites removed to expose reproductive system, carrefour and upper ovipositor cross-sectioned, nearside ovary and nearside filamentous gland and its reservoir removed; (Fig. 30) full dissection, dorsal view. Terminology after Boulard (1996a) and Duffels (1977). Terminology in brackets also in current use. (ag) accessory gland; (as) anal styles; (cf) carrefour; (co) common oviduct; (cpp, gp) copulapore, or gonopore; (dvp) dorsovaginal pouch; (fg) filamentous gland; (lo) lateral oviduct; (m) membrane; (o) ovipositor; (op) ovipore; (os) ovipositor sheath; (ov) ovary; (ovl) ovariole with eggs; (r) rectum; (rfg) reservoir of filamentous gland; (sa) seminal ampoule; (sg) spermathecal gland; (st VII) sternite VII; (tf) terminal filament of ovary.
Figs. 14–18 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Figs. 14–18. Male genitalia: (Fig. 14) lateral view, Neopsaltoda crassa, Cicadinae; (Fig. 15) ventral view, same species; (Fig. 16) lateral view, Kobonga umbrimargo, Cicadettinae (= Tibicininae auct.); (Fig. 17) ventral view, same species; (Fig. 18) aedeagus, lateral view, same species. Terminology after Duffels (1977), Dugdale [1972] and Orian (1964). (aed) aedeagus; (as) anal styles; (at) anal tube; (bl) basal lobe of pygofer; (bp) basal plate; (cl) clasper; (db) dorsal beak; (ds) distal shoulder; (end) endotheca; (gon) gonopore; (h) hinge; (mdl) median lobe of uncus; (psp) pseudoparamere; (pyg) pygofer; (ss) sclerital suture; (th) theca; (upl) upper lobe of pygofer; (vr) ventral rib; (vs) ventral support.
Figs. 5–6 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Figs. 5–6. Fore and hind wings, Tamasa tristigma, Cicadinae. Wing and cell notation (Fig. 5) adapted from Kukalová-Peck (1983) and Boulard (1996a) respectively; interpretation of venation (Fig. 6) after Dworakowska (1988). Terminologies in brackets are also in current use. (A) anal vein; (a) apical cell; (aa) anal angle; (ac1) anal cell 1; (ac2(v)) anal cell 2 or vannus; (ac3, j) anal cell 3 or jugum; (al) anal lobe (= ac2 + ac3); (ap) apex of wing; (arc) arculus; (av) ambient vein; (bc) basal cell; (bm) basal membrane; (C) costal vein; (cc) costal cell; (cf) claval fold; (clv) clavus; (cuc) cubital cell; (CuA) cubitus anterior vein; (CuP) cubitus posterior vein; (inf) infuscation; (jf) jugal fold; (nli) nodal line intersection; (no) node; (M) median vein; (m) medial crossvein; (ma) marginal area; (mc) medial cell, or ulnar cell 4 on fore wing; (m-cu) mediocubital crossvein; (n) node; (nl) nodal line; (p) plaga; (pt) pterostigma (pigmentation); (R) radius; (r) radial crossvein; (RA) radius anterior; (rc, dc) radial cell, or discal cell; (r-m) radiomedial crossvein; (Sc) subcostal vein; (u) ulnar cell; (vf) vannal fold; (wm) wing margin.
Fig. 40. Character 54 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 40. Character 54. Pygofer in lateral view showing upper lobe when flat, states 0–3: (0) small to moderately developed, distant from dorsal beak, rounded; (1) very well developed, dominating pygofer between basal lobe and dorsal beak, very flat; (2) well developed, dominating pygofer between basal lobe and dorsal beak, concave on inner face; (3) moderately developed with accessory "tooth".
Fig. 3 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 3. Male thorax, dorsal view with head in situ, Tamasa tristigma, Cicadinae. Terminology modified from Duffels (1977). Terminologies in brackets also in current use. (af) ambient fissure of pronotum; (ce, scl) cruciform elevation, or scutellum; (la) lateral angle of pronotal collar; (lf) lateral fissure; (lm) lateral margin of pronotal collar; (lp) lateral part of pronotal collar; (lsig) lateral sigilla; (mes) mesonotum; (met) metanotum; (pc) pronotal collar; (pf) paramedian fissure; (pro) pronotum; (ps) parapsidal suture; (sd) scutal depression; (ssig) submedian sigilla; (wg) wing groove.
Fig. 4 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 4. Male thorax, ventral view with head in situ but legs detached except for coxae, Tamasa tristigma, Cicadinae. Terminology after Kramer (1950). Terminologies in brackets also in current use. (aem 2) anepimeron 2; (aes 2) anepisternum 2; (bs 2) basisternum 2; (bs 3) basisternum 3; (eml, op 2) epimeral lobe, or operculum 2; (em 2) epimeron 2; (em 3) remnant of epimeron 3; (es 2) episternum 2; (es 3) episternum 3; (kem 2) katepimeron 2; (kes 2) katepisternum 2; (lm) lateral margin of pronotal collar; (mb) membrane; (mc, mn 3) meracanthus, or meron 3; (mn 2) meron 2; (op) operculum (includes epimeron 3); (pro) underside of pronotum; (st I) abdominal sternite I; (tn 2) trochantin 2; (tn 3) trochantin 3.
Fig. 34. Character 27. Fore wing outer margin, states 0 and 1 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 34. Character 27. Fore wing outer margin, states 0 and 1: (0) developed for its total length; (1) greatly reduced and in part contiguous with ambient vein.
Fig. 35. Character 32. Hind wing 1 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Fig. 35. Character 32. Hind wing 1st cubital cell width at distal ends, states 0 and 1: (0) about equal to 2nd cubital cell; (1) much greater than 2nd cubital cell (twice or more).
Figs. 25–26 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Figs. 25–26. Male genitalia and reproductive system: (Fig. 25) genitalia in situ, lateral view showing resting position of aedeagus and attachment of internal reproductive system, Tamasa tristigma, Cicadinae; (Fig. 26) reproductive system, full dissection, Tamasa tristigma, Cicadinae. Terminology adapted from Boulard (1996a) and Matsuda (1976). (aed) aedeagus; (ag) accessory gland; (bp) basal plate; (ejb) ejaculatory bulb; (ejd) ejaculatory duct; (hpi 8) hypopleurite 8; (im) intersegmental membrane; (pyg) pygofer; (sp 8) spiracle 8; (st VII–VIII) sternites VII and VIII; (sv) seminal vesicle; (tes) testis; (tesf) testicular follicles; (t 8) tergite 8; (un) uncus; (vd) vas deferens.
Figs. 12–13 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Figs. 12–13. Male abdomen, Tamasa tristigma, Cicadinae: (Fig. 12) dorsal view; (Fig. 13) ventral view. Terminology after Sweet (1996). (as) anal style; (aud) auditory capsule; (epi) epipleurite; (hpi) hypopleurite; (pyg) pygofer; (sp) spiracle; (st) sternite; (t) tergite; (tc) timbal cover; (tcav) timbal cavity; (tim) timbal; (tym) tympanum; (tymc) tympanal cavity.
Figs. 27–28 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna
Figs. 27–28. Female terminalia, Arunta perulata, Cicadinae: (Fig. 27) lateral view with ovipositor free of sheath; (Fig. 28) ventral view with ovipositor divided exposing ovipore and orifice of spermathecal gland. Terminology adapted from Boulard (1996a). Terminologies in brackets are also in current use. (ab 9) abdominal segment 9 or tergite 9; (as) anal styles; (cpp, gp) copulapore, or gonopore; (db) dorsal beak; (gx VIII–IX, vf 1–2) gonocoxites VIII and IX or valvifers 1 and 2; (gy VIII–X, va 1–3) gonapophyses VIII, IX or X or valvulae 1, 2 or 3; (hpi 7, 8) hypopleurites 7 and 8; (im) intersegmental membrane; (os) ovipositor sheath (= gonocoxite IX + gonapophysis X); (o) ovipositor (= gonapophyses VIII + IX); (ovp) ovipore; (sgo) orifice of spermathecal gland; (sp 7, 8) spiracles 7 and 8; (st VI, VII) sternites VI, VII; (stg) stigma; (t 6, 7, 8) tergites 6, 7 or 8.
Dataset of Universal 20 patterns with references
<p>A continuously growing dataset of more than 2000 languages, with references. A previous sample of 1687 languages is also available at the Terraling website <a href="http://terraling.com/groups/15">https://terraling.com/groups/15</a>.</p>
Data and code for 'Pseudogenes act as a neutral reference for detecting selection in prokaryotic pangenomes'
<p>This repository contains the code and files for reproducing the analyses and results reported in 'Pseudogenes act as a neutral reference for detecting selection in prokaryotic pangenomes' by Gavin M. Douglas and B. Jesse Shapiro (<a href="https://doi.org/10.1038/s41559-023-02268-6">https://doi.org/10.1038/s41559-023-02268-6</a>).</p> <p>File organization and descriptions:</p> <ul> <li><strong>code/</strong> - Contains GitHub repository releases of code used in manuscript (the other folders contain datafiles only). This code is provided here as well as on GitHub to ensure long-term access. <ul> <li><strong>handy_pop_gen-1.1.0/</strong> - release v1.1.0 of the convenience repository (used for specific data processing and analysis steps referred to in the manuscript).</li> <li><strong>pangenome_pseudogene_null-1.1.0/ </strong>- Main code repository for manuscript.</li> </ul> </li> </ul> <p> </p> <ul> <li><strong>broad_pangenome_analysis/</strong> <ul> <li><strong>element_info/element_counts.tsv.gz</strong> - Counts of (filtered) pseudogenes and intact genes called per genome accession.</li> <li><strong>element_info/gene_sizes.tsv.gz</strong> - Gene sizes in base-pairs.</li> <li><strong>element_info/pseudogene_sizes.tsv.gz</strong> - Filtered pseudogene sizes in base-pairs.</li> <li><strong>element_info/element_percent_coverage/*tsv.gz</strong> - Tables containing the percent genome coverage of genes and pseudogenes, by accession and averaged over accessions per species separately.</li> <li><strong>example_Mycoplasmopsis_bovis_panaroo_output.csv.gz</strong> - Panaroo output table for <em>Mycoplasmopsis bovis</em>, which was used for an example. Corresponds to the <em>gene_presence_absence.csv</em> file in the raw Panaroo output.</li> <li><strong>focal_and_non.focal_full_to_short.tsv.gz</strong> - Mapfile of full to short (and unique) species ids used in analysis. Primarily to include species ids in cluster names without making them unnecessarily long.</li> <li><strong>genome_info/accessions.tsv.gz</strong> - Genome accessions used for broad pangenome analysis (note that not all genome accessions could be downloaded [and were ignored], which is indicated in the "could_download" column).</li> <li><strong>genome_info/genome_sizes.tsv.gz</strong> - Sizes of all genomes used for the broad pangenome analysis.</li> <li><strong>metrics_additional_subsamples.tsv.gz</strong> - Contains columns also found in the <em>pangenome_and_related_metrics.tsv.gz</em> file below, but based on genome subsamplings of 3 and 20, rather than 9.</li> <li><strong>model_output/pangenome_linear_models.rds</strong> - R Data Serialization files containing the output of R linear model objects (generated by lm and provided as an R list object). There are separate elements in the list for the mean number of genes, genomic fluidity, percentage singletons (si), and si/sp.</li> <li><strong>model_output/linear_model_coef.tsv.gz</strong> - Coefficient summary table for all linear models.</li> <li><strong>pangenome_and_related_metrics.tsv.gz</strong> - Metrics used for broad pangenome analysis across 670 prokaryotic species. Note that this table was filtered down to 668 species after excluding those with < 9 genomes.</li> <li><strong>pangenome_and_related_metrics_filt.tsv.gz</strong> - Filtered table, as described above.</li> <li><strong>taxonomy.tsv.gz</strong> - Taxonomy for all species used for this analysis, taken from GTDB. Row names are species names.</li> </ul> </li> </ul> <p> </p> <ul> <li><strong>indepth_10_species_analysis/</strong> <ul> <li><strong>cluster_breakdown_tables/</strong> - Folder containing tables providing breakdown of how clusters are distributed by element type, pangenome partition, and species. Provided for easy plotting.</li> <li><strong>cluster_COG_annot.tsv.gz</strong> - Mapping of cluster IDs to COG annotations.</li> <li><strong>cluster_filt_lengths_and_additional.tsv.gz</strong> - Metadata on clusters, most pertinently the length of the representative sequence in the cluster (which was used to filter out some clusters, below the cut-off which pseudogenes could not be called).</li> <li><strong>cluster_member_breakdown.tsv.gz </strong>- Table providing information on each element (called pseudogenes and intact genes) and provides information such as what cluster they are part of, what species and genome accession they are found in, etc.</li> <li><strong>cluster_types.rds</strong> - R Data Serialization file containing R list providing breakdown of all clusters into categories (intact/pseudogene/mixed, where mixed means containing both pseudogene and intact elements).</li> <li><strong>COG_enrichment_results/ultra.cloud-COG-gene-enrichments.tsv.gz</strong> - Output file with enrichment test summaries for COG IDs in significant COG categories, which was run for the ultra-cloud pangenome partition model only.</li> <li><strong>element_glmm_input.tsv.gz </strong>- Table containing all information used for fitting generalized linear mixed models.</li> <li><strong>focal_species.txt</strong> - Names of species used for the in-depth analysis.</li> <li><strong>genome_info/ </strong>- Folder containing the genome accessions (and the corresponding genome sizes) for all ten analyzed species.</li> <li><strong>glmm_output/</strong> - Folder containing R Data Serialization files containing output R objects after fitting generalized linear mixed models (only ultra-rare files are present, due to file size constraints).</li> <li><strong>per_genome_element.type_percent_coverages.rds</strong> - R Data Serialization file containing R list providing the percent coverage by intact genes vs pseudogenes per accession (nested by species)</li> </ul> </li> </ul>
rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 .</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p>
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.