Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
4,182
datasets available to search
ShareScore release 0.9.0
Dataset results
4,182 results for “universities”
Data source for "A universal programmable Gaussian Boson Sampler for drug discovery"
<p>Source Data for the figures in paper.</p>
Data technostress in university students in Lima
<p>The information was collected using the TS4US scale, previously validated in Spanish in Spain and Chile, and which in this case has been tested with confirmatory factor analysis (CFA) for a sample of 328 university students from four areas of Lima.</p>
Dataset for "Universal scaling of the dynamic BKT transition in quenched 2D Bose gases"
<p>This repository contains data and numerical simulation code for Sunami et. al., "Universal scaling of the dynamic BKT transition in quenched 2D Bose gases".</p> <p>The data is stored in the format of hdf5 (Hierarchical Data Format), which can be read from standard programming environment such as python (h5py), matlab (`h5read`), and many others.</p> <p>Numerical simulation scripts consist of functions.c, MonteCarloSampling.cpp and phase12_den_sample_time.cpp. Please see the section for numerical simulation in the Supplementary Material.</p> <p>The description for each hdf5 file in this repository is provided in readme.txt.</p>
rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 .</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p>
rCRUX Generated MiFish Universal 12S Expanded Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
UniFMIR: Pre-training a Foundation Model for Universal Fluorescence Microscopy Image Restoration
<p>This repository contains the preprocessed dataset for [UniFMIR](https://github.com/cxm12/UNiFMIR/). All training and test data involved in the experiments are publicly available datasets. Licenses of the original dataset are applied. You can refer to the Github repository for details.</p> <p>* The 3D denoising/isotropic reconstruction/projection datasets can be downloaded from [Content Aware Image Restoration dataset](https://publications.mpi-cbg.de/publications-sites/7207/). `Projection_Flywing/train_data/my_training_data.npz` are generated according to the [CSBDeep](http://csbdeep.bioimagecomputing.com/doc/).</p> <p>* The SR dataset can be downloaded from [BioSR dataset](https://doi.org/10.6084/m9.figshare.13264793). The dataset is augmented according to the instructions in [DFCAN](https://github.com/qc17-THU/DL-SR/tree/main#train-a-new-model) and `my_training_data.npz` files are generated following [CSBDeep](http://csbdeep.bioimagecomputing.com/doc/datagen.html). </p> <p>* The Volumetric reconstruction dataset are from [VCD-LFM dataset](https://doi.org/10.5281/zenodo.4390067). The dataset is prepared according to the instructions in [VCD-Net](https://github.com/feilab-hust/VCD-Net).</p> <p>* DeepBacs dataset can be downloaded from [DeepBacs dataset](https://zenodo.org/record/6460867). We split the dataset into 5 folds for cross-validation. Shareloc dataset can be downloaded from [Shareloc dataset](https://zenodo.org/record/7234161).</p> <p> </p> <p>The data paths should be as follows:</p> <p>```</p> <p>VCD/vcdnet/</p> <p>CSB/DataSet/</p> <p> Denoising_Planaria/</p> <p> Denoising_Tribolium/</p> <p> Isotropic/Isotropic_Liver/</p> <p> Projection_Flywing/</p> <p> BioSR_WF_to_SIM/DL-SR-main/dataset/</p> <p> Synthetic_tubulin_gfp/</p> <p> Synthetic_tubulin_granules/</p> <p>DeepBacs/</p> <p>Shareloc/</p> <p>```</p>
rCRUX Generated MiFish Universal 12S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Experiment replication - Gould 1684 (Johns Hopkins University, Baltimore, USA, 6/6/2022)
<p>Replication in laboratory of an experiment reported by William Gould, “An Account of the increase of weight in oyl of vitriol expos’d to the air,” <em>Philosophical Transactions</em> 14(156): 496–506 (1684):</p> <p>“On the ninth of No[vember] 1683. Three drams of oyl of vitriol so far dephlegm’d as to burn or corrode a strong packthred assunder, was expos’d to the air in a marmalade glass of three inches diameter, and plac’t in a nice pair of scales, in a room where no fire nor sun came; its increase for 7 natural days divided by less portions of time was according to the following table [...] upon the view of the whole diary of almost two months; it appear’d, the increase was more in a moist, rainy, misty, and snowy, but less in a frofty, clear, and dry seafon, as also was more in a cold than in a warm air” (pp. 497 & segg.)</p> <p>“All these circumstances which relate to the quantity will also influence very much the time of the encrease, the last thing to be consider’d in the experiment; but I shall only mention that which makes the most peculiar and principal variation in this point, and tis the proportion of the surface to the the liquor. For I find the greater or less the surface is, the quicker or slower the encrease [...] I expos’d in the same room and to the same temper of the air (as near as I could guess) three drams of the same oyl of vitriol in an open flat glass one inch broad, being only 2/3 of the diameter of that glass us’d at first with the like quantity. The result was this; that whereas the other surface of three inches diameter gain’d (as in the table) near nineteen grains the first six hours, this less surface gained a very little perceivable more then two grains in the same space of time” (pp. 503-504).</p> <p>The (potential) significance of this experiment for the debate on mineral generation lies also in the fact that it is mentioned by J.F. Henckel, <em>Pyritologia</em> (1721, Engl. transl. 1757): “Dr. Gould, of Oxford, has observed, that oil of vitriol does, by means of the air, encrease in weight, having, for that purpose, exposed a highly dephlegmated oil in an open wide glass, and weighed it accurately every day. In the space of fifty seven days three drachms of oil of vitriol came to nine drachms thirdy grains. The first day the oil increased one drachm and eight grains, afterwards, from day to day, still less, nay, the last day, scarce half a grain. This succeeds in moist foggy weather better than in dry, also in a wide than narrow vessel” (Henckel 1757, p. 374).</p> <p>Date: June 6, 2022</p> <p>Place: Johns Hopkins University, Baltimore (MD), US</p> <p>Project and Funding Source: Horizon 2020 – MGA MSCA-IF – Grant agreement No. 101019781 – SOUNDEPTH</p> <p>Work Package: 4</p>
Experiment replication - De Beaumont 1676 (Johns Hopkins University, Baltimore, USA, 6/6/2022)
<p>Replication in laboratory of an experiment reported by John de Beaumont, “Two letters... concerning rock-plants and their growth,” <em>Philosophical Transactions</em> 11: 724–742 (1676):</p> <p>“Those who endeavour to explicate those figurations mechanically, seem to have a harder task; for, if they say with Hippocrates, <em>Spiritu distenta omnia progeneris affinitate distant;</em> as though, when the mineral spirit had extended the matter, it fell into those figures upon a spontaneous recess according to its proper weight, which gives order and measure to things; as he mechanically shews by a bladder, into which if earth, sand, and filings of lead be put, and water be added to them, and we give them motion by blowing in the bladder through a reed, first they are mixt together with the water, but in a while continuing in a gentle motion they separate themselves and retire each to its like, the lead to the lead &c.” (p. 740)</p> <p>Date: June 6, 2022</p> <p>Place: Johns Hopkins University, Baltimore (MD), US</p> <p>Project and Funding Source: Horizon 2020 – MGA MSCA-IF – Grant agreement No. 101019781 – SOUNDEPTH</p> <p>Work Package: 4</p>
Experiment replication - Sendivogius 1604 (Johns Hopkins University, Baltimore, USA, 6/6/2022)
<p>Replication in laboratory of an experiment reported by Michael Sendivogius, <em>De lapide philosophorum/Novum lumen chymicum</em> (1604):</p> <p>In explaining the operation of the mineral seed (“Sperma”): “Exempli gratia, habeatur in aliqua mensa plana vasculum aquae, quod locetur in mensae medium, et circumcirca ponantur res variae, et colores varii, item sal et cetera, quodque separatim: effundatur postea aqua in medium, videbis illam aquam hic inde diffluere, et dum rivulus uno attinget colorem rubeum, rubefiet ab illo, si ad salem, salis saporem mutabitur, et sic de caeteris. Aqua enim loca non mutat, sed locorum diversitas mutat aquam. Simili modo e centro Terrae semen vel sperma a quatuor elementis in centrum proiectum ad varia loca transit, et secundum loci Naturam naturatur res, si pervenit ad locum terrae et aquae purum, fit res pura” (pp. 22-23)</p> <p>Date: June 6, 2022</p> <p>Place: Johns Hopkins University, Baltimore (MD), US</p> <p>Project and Funding Source: Horizon 2020 – MGA MSCA-IF – Grant agreement No. 101019781 – SOUNDEPTH</p> <p>Work Package: 4</p>
Linked collectors and determiners for: Type specimen collections of Turku University.
Natural history specimen data linked to collectors and determiners held within, "Type specimen collections of Turku University". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="http://bionomia.net/dataset/aabcc8c1-ed59-4f3f-81db-948c9952503d">https://bionomia.net/dataset/aabcc8c1-ed59-4f3f-81db-948c9952503d</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/aabcc8c1-ed59-4f3f-81db-948c9952503d">https://gbif.org/dataset/aabcc8c1-ed59-4f3f-81db-948c9952503d</a>. Formatted as a Frictionless Data package.
Longitudinal COVID-19 Antibody Testing in Indiana University Undergraduate Students
ClinicalTrials.gov study NCT04620798. IPD Sharing: YES. Countries: 1. Publications: 2.
Healthy beverage initiatives: A case study of scenarios for optimizing their environmental benefits on a university campus
Open the record for dataset details and reuse information.
Data from: Variations in regional white matter volumetry and microstructure during the post-adolescence period: a cross-sectional study of a cohort of 1,713 university students
Open the record for dataset details and reuse information.
Universal temperature sensitivity of denitrification nitrogen losses in forest soils
Open the record for dataset details and reuse information.
Taxon-specific or universal? Using target capture to study the evolutionary history of a rapid radiation
Open the record for dataset details and reuse information.
Data from: The MRi-Share database: Brain imaging in a cross-sectional cohort of 1,870 university students
Open the record for dataset details and reuse information.
University of Kansas Field Station: Water temperature profiles at Frank B. Cross Reservoir (Kansas, USA) 1993-2016
These vertical profiles of water temperature data are from Frank B. Cross Reservoir, a small freshwater impoundment in northeastern Kansas (USA). Cross Reservoir, located at the University of Kansas Field Station near Lawrence (KS), has a 3-ha surface area and a maximum depth of 12 m. Temperature data were collected at discrete depths in a vertical profile using a Water Quality Checker U-10 (Horiba Instruments, Kyoto, Japan). These temperature data were collected in conjunction with ecological studies at Cross Reservoir examining deep-dwelling, vertically-migrating phytoplankton communities that form a deep chlorophyll maxima, especially during times of thermal stratification. Therefore, the most frequent sampling dates occurred in July, August, September and October during thermal stratification when vertically migrating deep algae were most common (other months were sampled less frequently through the years). Cross Reservoir has high water clarity due to its watershed vegetation and physical (protected) setting. Thermal stratification begins each year in April, and complete mixing occurs during November. The bottom of the epilimnion is typically located at 3 m in July and usually deepens to approximately 9 m by late November. The bottom of the epilimnion is defined here as the bottom of the first 1 m depth interval that exhibited a >1 C temperature decrease per meter. The water column also consistently exhibits strong chemical stratification during the summer months. Sporadic ice cover can occur during December–February.
Weather data for the period 2016 to 2022 from the HH1 Greenhouse location at University Farms, Case Western Reserve University
Data from the HH1 weather station at University Farms of Case Western Reserve University include observations from 2016 to 2022. University Farms is located in Hunting Valley, Ohio. The weather station was located N 41.493371, W81.422504. Data include date/time (in 15-minute intervals), air temperature, relative humidity, wind speed, wind gust speed, wind direction, and solar radiation.
Annual tree growth for Red and Sugar Maples in six forest plots distributed around Ann Arbor, MI and around the University of Michigan Biological Station (UMBS), 1999 to 2022
The dataset contains the annual growth, in mm, of over 200 red and sugar maple trees. All trees are located in established study sites in the vicinity of Ann Arbor or UMBS.
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.