Find research datasets worth reusing

opencc-by-4.0May 2024View details →

rCRUX Generated MiFish Universal 12S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in January 2024. Primer Name:  MiFish Universal Gene:   12S Length of Target:    163–185 get_seeds_local() minimum length:    170 get_seeds_local() maximum length:    400 blast_seeds() minimum length:    140 blast_seeds() maximum length:    400 max_to_blast:  1000 Forward Sequence (5'-3'):   GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'):    CATAGTGGGGTATCTAATCCCAGTTTG Reference:    Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.     This project was funded by the NOAA 'Omics Program.

opencc-by-4.0May 2024View details →

BFR2: a curated benthic foraminifera ribosomal reference database

The present data set provides a fasta file, a tab-separated text file, and an Excel file. The fasta file includes 5,324 18S rDNA reference sequences for benthic foraminifera. The tab-separated text file includes the following fields: BFR2 number = unique internal sequence accession number; length = sequence length; class = class to which each sequence is assigned; order/suborder/clade = order/suborder/clade to which each sequence is assigned; family = family to which each sequence is assigned; genus = genus to which each sequence is assigned; species = species to which each sequence is assigned; isolate number = unique DNA extraction number; clone/direct: indicates whether it has been directly sequenced or cloned; genbank_accession = NCBI sequence accession number; sampling site = biogeographic region where the specimen has been collected; latitude in decimal degrees, longitude in decimal degrees; collection date = year in which specimen was collected; collector = person who collected the specimen; publication = publication associated to the sequence; journal = journal associated to publication; first author = first author associated to publication/sequence; taxonomic remarks = additional taxonomic information/comment; sampling remarks = addional sampling information/comment. List of added or updated: - Clone/direct: indicates whether it has been directly sequenced or cloned. - Latitude and longitude in decimal degrees. - Genbank accession number of 1700 18S rRNA sequences added.

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Meliaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Meliaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514">https://bionomia.net/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514">https://gbif.org/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Rubiaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Rubiaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/c3caca74-616b-4bad-b795-b13adff022de">https://bionomia.net/dataset/c3caca74-616b-4bad-b795-b13adff022de</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/c3caca74-616b-4bad-b795-b13adff022de">https://gbif.org/dataset/c3caca74-616b-4bad-b795-b13adff022de</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database about reference specimens of the Anacardiaceae family owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens of the Anacardiaceae family owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4">https://bionomia.net/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4">https://gbif.org/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Fabaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Fabaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/72414bd9-69dc-461c-8034-b7d895eccf63">https://bionomia.net/dataset/72414bd9-69dc-461c-8034-b7d895eccf63</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/72414bd9-69dc-461c-8034-b7d895eccf63">https://gbif.org/dataset/72414bd9-69dc-461c-8034-b7d895eccf63</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Sapotaceae family, owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Sapotaceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/65174786-b679-46f1-b5a4-34f466e9241a">https://bionomia.net/dataset/65174786-b679-46f1-b5a4-34f466e9241a</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/65174786-b679-46f1-b5a4-34f466e9241a">https://gbif.org/dataset/65174786-b679-46f1-b5a4-34f466e9241a</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Asteraceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Asteraceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3">https://bionomia.net/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3">https://gbif.org/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Moraceae family, owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Moraceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0">https://bionomia.net/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0">https://gbif.org/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Euphorbiaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Euphorbiaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/073938a7-50e8-446e-8884-035b0639982c">https://bionomia.net/dataset/073938a7-50e8-446e-8884-035b0639982c</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/073938a7-50e8-446e-8884-035b0639982c">https://gbif.org/dataset/073938a7-50e8-446e-8884-035b0639982c</a>. Formatted as a Frictionless Data package.

Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Apocynaceae family, owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Apocynaceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb">https://bionomia.net/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb">https://gbif.org/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb</a>. Formatted as a Frictionless Data package.

opencc-by-4.0Aug 2003View details →

Fig. 1 in A revised comprehensive checklist, relational database, and taxonomic system of reference for the bristly millipedes of the world (Diplopoda, Polyxenida)

Fig. 1. Polyxenus lagurus (Linnaeus, 1758). Habitus of an adult male, bisexual form, dorsal view, after Nguyen Duy - Jacquemin, 1996 (by kind permission of Millepattia). Drawing by Maurice Gaillard. Length = 4 mm.

opencc-by-4.0Aug 2003View details →

Fig. 2 in A revised comprehensive checklist, relational database, and taxonomic system of reference for the bristly millipedes of the world (Diplopoda, Polyxenida)

Fig. 2. Propolyxenus forsteri Condé, 1951. Habitus of an adult male, dorsal view. Drawing by Christine Beau. Length = 3.5 mm.

dryad40/100

Data from: A global reference database in FAOSTAT of cropland nutrient budgets and nutrient use efficiency: nitrogen, phosphorus and potassium, 1961–2020

Agricultural nutrient budgets help to identify an excess or an insufficiency in use of fertilizers and other nutrient sources. Nutrient budgets allow for indicators such as the nutrient balance (surplus or deficit) and nutrient use efficiency to be estimated. This can help in the monitoring of agricultural productivity and sustainability globally. The present dataset is a global database of country-level budget estimates for nitrogen (N), phosphorus (P) and potassium (K) in cropland. The database is disseminated in FAOSTAT and provides a global reference, synthesizing and continuously updating the state-of-the-art on this topic. The database covers the period 961 to 2020 for 205 countries and territories, as well as regional and global aggregates. Results indicate the wide range in nutrient use and use efficiencies across regions, nutrients, and time. This dataset introduces improvements over previous work in relation to key nutrient coefficients affecting nutrient budgets and use efficiency estimates. This is especially for nutrient removal in crop products, manure nutrient content, atmospheric deposition and crop biological N fixation rates.

opencc-zeroDec 2022View details →

opencc-by-4.0Oct 2023View details →

rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 . Primer Name:  MiFish Universal Gene:   12S Length of Target:    163–185 get_seeds_local() minimum length:    170 get_seeds_local() maximum length:    250 blast_seeds() minimum length:    140 blast_seeds() maximum length:    250 max_to_blast:  1000 Forward Sequence (5'-3'):   GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'):    CATAGTGGGGTATCTAATCCCAGTTTG Reference:    Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Cephalpod 18S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Ceph18S Gene:   18S Length of Target:    150–190 get_seeds_local() minimum length:    105 get_seeds_local() maximum length:    235 blast_seeds() minimum length:    65 blast_seeds() maximum length:    195 max_to_blast:  100 Forward Sequence (5'-3'):   CGCGGCGCTACATATTAGAC Reverse Sequence (5'-3'):    GCACTTAACCGACCGTCGAC Reference:    D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021) <a href="https://doi.org/10.1098/rsos.201388">https://doi.org/10.1098/rsos.201388</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated MiFish Universal 12S Expanded Reference Database

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022. Primer Name:  MiFish Universal Gene:   12S Length of Target:    163–185 get_seeds_local() minimum length:    170 get_seeds_local() maximum length:    250 blast_seeds() minimum length:    140 blast_seeds() maximum length:    250 max_to_blast:  1000 Forward Sequence (5'-3'):   GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'):    CATAGTGGGGTATCTAATCCCAGTTTG Reference:    Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Fungal ITS Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Fungal_ITS gITS7/ITS4 Gene:   FITS Length of Target:    150-330 get_seeds_local() minimum length:    105 get_seeds_local() maximum length:    500 blast_seeds() minimum length:    65 blast_seeds() maximum length:    461 max_to_blast:  100 Forward Sequence (5'-3'):   GTGARTCATCGARTCTTTG Reverse Sequence (5'-3'):    TCCTCCGCTTATTGATATGC Reference:    White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315–322. Ihrmark, K., Bödeker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., & Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region–evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Ford Fish 16S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Ford Fish 16S Gene:   16S Length of Target:    330 get_seeds_local() minimum length:    279 get_seeds_local() maximum length:    477 blast_seeds() minimum length:    231 blast_seeds() maximum length:    429 max_to_blast:  1000 Forward Sequence (5'-3'):   GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC Reverse Sequence (5'-3'):    GGATTGCGCTGTTATCCCTA Reference:    Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population’s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated ITS2 Plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  ITS2 Plants Gene:   ITS2 Length of Target:    450-550 get_seeds_local() minimum length:    315 get_seeds_local() maximum length:    600 blast_seeds() minimum length:    270 blast_seeds() maximum length:    560 max_to_blast:  100 Forward Sequence (5'-3'):   ATGCGATACTTGGTGTGAAT Reverse Sequence (5'-3'):    GACGCTTCTCCAGACTACAAT Reference:    Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... & Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. <a href="https://doi.org/10.1371/journal.pone.0067818">https://doi.org/10.1371/journal.pone.0067818</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.