Skip to main content
Powered by ShareScore

Find research datasets worth reusing

Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.

103

datasets available to search

ShareScore release 0.9.0

Reset

Dataset results

103 results for “reference database”

Learn how ShareScore rates datasets ↗
zenodo40/100

rCRUX Generated MiFish Universal 12S Reference Database

<p>rCRUX generated reference database using NCBI nt blast database downloaded in January 2024.</p> <p>Primer Name:&nbsp; MiFish Universal<br>Gene:&nbsp; &nbsp;12S<br>Length of Target:&nbsp; &nbsp; 163&ndash;185<br>get_seeds_local() minimum length:&nbsp; &nbsp; 170<br>get_seeds_local() maximum length:&nbsp; &nbsp; 400<br>blast_seeds() minimum length:&nbsp; &nbsp; 140<br>blast_seeds() maximum length:&nbsp; &nbsp; 400<br>max_to_blast:&nbsp;&nbsp;1000<br>Forward Sequence (5'-3'):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br>Reverse Sequence (5'-3'):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br>Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. &nbsp;</p> <p>&nbsp;</p> <p>This project was funded by the NOAA 'Omics Program.</p>

opencc-by-4.0May 2024View details →
zenodo40/100

BFR2: a curated benthic foraminifera ribosomal reference database

<p>The present data set provides a fasta file, a tab-separated text file, and an Excel file. The fasta file includes 5,324 18S rDNA reference sequences for benthic foraminifera. The tab-separated text file includes the following fields: BFR2 number = unique internal sequence accession number; length = sequence length; class = class to which each sequence is assigned; order/suborder/clade = order/suborder/clade to which each sequence is assigned; family = family to which each sequence is assigned; genus = genus to which each sequence is assigned; species = species to which each sequence is assigned; isolate number = unique DNA extraction number; clone/direct: indicates whether it has been directly sequenced or cloned; genbank_accession = NCBI sequence accession number; sampling site = biogeographic region where the specimen has been collected; latitude in decimal degrees, longitude in decimal degrees; collection date = year in which specimen was collected; collector = person who collected the specimen; publication = publication associated to the sequence; journal = journal associated to publication; first author = first author associated to publication/sequence; taxonomic remarks = additional taxonomic information/comment; sampling remarks = addional sampling information/comment.<br><br>List of added or updated:<br>- Clone/direct: indicates whether it has been directly sequenced or cloned.<br>- Latitude and longitude in decimal degrees.<br>- Genbank accession number of 1700 18S rRNA sequences added.</p>

opencc-by-4.0May 2024View details →
zenodo40/100

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Meliaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Meliaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514">https://bionomia.net/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514">https://gbif.org/dataset/f0ad347c-dfaf-4326-9bb3-5e25f9b45514</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Rubiaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Rubiaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/c3caca74-616b-4bad-b795-b13adff022de">https://bionomia.net/dataset/c3caca74-616b-4bad-b795-b13adff022de</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/c3caca74-616b-4bad-b795-b13adff022de">https://gbif.org/dataset/c3caca74-616b-4bad-b795-b13adff022de</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database about reference specimens of the Anacardiaceae family owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens of the Anacardiaceae family owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4">https://bionomia.net/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4">https://gbif.org/dataset/ab5f0353-364a-4e1a-bbaa-6de46cafe1b4</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Fabaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Fabaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/72414bd9-69dc-461c-8034-b7d895eccf63">https://bionomia.net/dataset/72414bd9-69dc-461c-8034-b7d895eccf63</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/72414bd9-69dc-461c-8034-b7d895eccf63">https://gbif.org/dataset/72414bd9-69dc-461c-8034-b7d895eccf63</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Sapotaceae family, owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Sapotaceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/65174786-b679-46f1-b5a4-34f466e9241a">https://bionomia.net/dataset/65174786-b679-46f1-b5a4-34f466e9241a</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/65174786-b679-46f1-b5a4-34f466e9241a">https://gbif.org/dataset/65174786-b679-46f1-b5a4-34f466e9241a</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Asteraceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Asteraceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3">https://bionomia.net/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3">https://gbif.org/dataset/54661f8e-3d4e-41cb-b8c1-ac9298f020d3</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Moraceae family, owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Moraceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0">https://bionomia.net/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0">https://gbif.org/dataset/269348c6-8dd2-4d59-84ae-27c82b47c2c0</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database on reference specimens for medicinal plants of the Euphorbiaceae family, conserved at the CNARP herbarium.

Natural history specimen data linked to collectors and determiners held within, "Database on reference specimens for medicinal plants of the Euphorbiaceae family, conserved at the CNARP herbarium". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/073938a7-50e8-446e-8884-035b0639982c">https://bionomia.net/dataset/073938a7-50e8-446e-8884-035b0639982c</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/073938a7-50e8-446e-8884-035b0639982c">https://gbif.org/dataset/073938a7-50e8-446e-8884-035b0639982c</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Linked collectors and determiners for: Database about reference specimens for medicinal plants, in the Apocynaceae family, owned by CNARP.

Natural history specimen data linked to collectors and determiners held within, "Database about reference specimens for medicinal plants, in the Apocynaceae family, owned by CNARP". Claims or attributions were made on Bionomia by volunteer Scribes, <a href="https://bionomia.net/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb">https://bionomia.net/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb</a> using specimen data from the dataset aggregated by the Global Biodiversity Information Facility, <a href="https://gbif.org/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb">https://gbif.org/dataset/00cdcfb5-db92-4839-9b43-45950cb33bcb</a>. Formatted as a Frictionless Data package.

opencc-zeroJan 2024View details →
zenodo40/100

Fig. 1 in A revised comprehensive checklist, relational database, and taxonomic system of reference for the bristly millipedes of the world (Diplopoda, Polyxenida)

Fig. 1. Polyxenus lagurus (Linnaeus, 1758). Habitus of an adult male, bisexual form, dorsal view, after Nguyen Duy - Jacquemin, 1996 (by kind permission of Millepattia). Drawing by Maurice Gaillard. Length = 4 mm.

opencc-by-4.0Aug 2003View details →
zenodo40/100

Fig. 2 in A revised comprehensive checklist, relational database, and taxonomic system of reference for the bristly millipedes of the world (Diplopoda, Polyxenida)

Fig. 2. Propolyxenus forsteri Condé, 1951. Habitus of an adult male, dorsal view. Drawing by Christine Beau. Length = 3.5 mm.

opencc-by-4.0Aug 2003View details →
dryad40/100

Data from: A global reference database in FAOSTAT of cropland nutrient budgets and nutrient use efficiency: nitrogen, phosphorus and potassium, 1961–2020

<p class="MsoNormal">Agricultural nutrient budgets help to identify an excess or an insufficiency in use of fertilizers and other nutrient sources. Nutrient budgets allow for indicators such as the nutrient balance (surplus or deficit) and nutrient use efficiency to be estimated. This can help in the monitoring of agricultural productivity and sustainability globally. The present dataset is a global database of country-level budget estimates for nitrogen (N), phosphorus (P) and potassium (K) in cropland. The database is disseminated in FAOSTAT and provides a global reference, synthesizing and continuously updating the state-of-the-art on this topic. The database covers the period 961 to 2020 for 205 countries and territories, as well as regional and global aggregates. Results indicate the wide range in nutrient use and use efficiencies across regions, nutrients, and time. This dataset introduces improvements over previous work in relation to key nutrient coefficients affecting nutrient budgets and use efficiency estimates. This is especially for nutrient removal in crop products, manure nutrient content, atmospheric deposition and crop biological N fixation rates. </p>

opencc-zeroDec 2022View details →
zenodo40/100

rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022&nbsp;and supplemented with the FishCARD sequences from&nbsp;https://doi.org/10.5281/zenodo.4315277 .</p> <p>Primer Name:&nbsp; MiFish Universal<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 163&ndash;185<br> get_seeds_local() minimum length:&nbsp; &nbsp; 170<br> get_seeds_local() maximum length:&nbsp; &nbsp; 250<br> blast_seeds() minimum length:&nbsp; &nbsp; 140<br> blast_seeds() maximum length:&nbsp; &nbsp; 250<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p> <p>&nbsp;</p>

opencc-by-4.0Oct 2023View details →
zenodo40/100

rCRUX Generated Cephalpod 18S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Ceph18S<br> Gene:&nbsp; &nbsp;18S<br> Length of Target:&nbsp; &nbsp; 150&ndash;190<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 235<br> blast_seeds() minimum length:&nbsp; &nbsp; 65<br> blast_seeds() maximum length:&nbsp; &nbsp; 195<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;CGCGGCGCTACATATTAGAC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GCACTTAACCGACCGTCGAC<br> Reference:&nbsp; &nbsp; D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021)&nbsp;<a href="https://doi.org/10.1098/rsos.201388">https://doi.org/10.1098/rsos.201388</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated MiFish Universal 12S Expanded Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.</p> <p>Primer Name:&nbsp; MiFish Universal<br> Gene:&nbsp; &nbsp;12S<br> Length of Target:&nbsp; &nbsp; 163&ndash;185<br> get_seeds_local() minimum length:&nbsp; &nbsp; 170<br> get_seeds_local() maximum length:&nbsp; &nbsp; 250<br> blast_seeds() minimum length:&nbsp; &nbsp; 140<br> blast_seeds() maximum length:&nbsp; &nbsp; 250<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference:&nbsp; &nbsp; Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... &amp; Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088.&nbsp;<a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Fungal ITS Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Fungal_ITS gITS7/ITS4<br> Gene:&nbsp; &nbsp;FITS<br> Length of Target:&nbsp; &nbsp; 150-330<br> get_seeds_local() minimum length:&nbsp; &nbsp; 105<br> get_seeds_local() maximum length:&nbsp; &nbsp; 500<br> blast_seeds() minimum length:&nbsp; &nbsp; 65<br> blast_seeds() maximum length:&nbsp; &nbsp; 461<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GTGARTCATCGARTCTTTG<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; TCCTCCGCTTATTGATATGC<br> Reference:&nbsp; &nbsp; White, T. J., Bruns, T., Lee, S., &amp; Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315&ndash;322.<br> Ihrmark, K., B&ouml;deker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandstr&ouml;m-Durling, M., &amp; Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region&ndash;evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666&ndash;677.&nbsp;https://doi.org/10.1111/j.1574-6941.2012.01437.x</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated Ford Fish 16S Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; Ford Fish 16S<br> Gene:&nbsp; &nbsp;16S<br> Length of Target:&nbsp; &nbsp; 330<br> get_seeds_local() minimum length:&nbsp; &nbsp; 279<br> get_seeds_local() maximum length:&nbsp; &nbsp; 477<br> blast_seeds() minimum length:&nbsp; &nbsp; 231<br> blast_seeds() maximum length:&nbsp; &nbsp; 429<br> max_to_blast:&nbsp;&nbsp;1000<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GGATTGCGCTGTTATCCCTA<br> Reference:&nbsp; &nbsp; Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population&rsquo;s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956</p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →
zenodo40/100

rCRUX Generated ITS2 Plants Reference Database

<p>rCRUX generated reference database&nbsp;using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name:&nbsp; ITS2 Plants<br> Gene:&nbsp; &nbsp;ITS2<br> Length of Target:&nbsp; &nbsp; 450-550<br> get_seeds_local() minimum length:&nbsp; &nbsp; 315<br> get_seeds_local() maximum length:&nbsp; &nbsp; 600<br> blast_seeds() minimum length:&nbsp; &nbsp; 270<br> blast_seeds() maximum length:&nbsp; &nbsp; 560<br> max_to_blast:&nbsp;&nbsp;100<br> Forward Sequence (5&#39;-3&#39;):&nbsp; &nbsp;ATGCGATACTTGGTGTGAAT<br> Reverse Sequence (5&#39;-3&#39;):&nbsp; &nbsp; GACGCTTCTCCAGACTACAAT<br> Reference:&nbsp; &nbsp; Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... &amp; Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818.&nbsp;<a href="https://doi.org/10.1371/journal.pone.0067818">https://doi.org/10.1371/journal.pone.0067818</a></p> <p>We chose default rCRUX parameters for&nbsp;<em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = &#39;100000000&#39; and for&nbsp;<em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = &#39;10000000&#39;. &nbsp;</p>

opencc-by-4.0May 2023View details →

ScienceDex guides

Understand access before you commit

These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.

Compare curated datasets

Allen Brain Atlas

Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.

allen-brain-atlas
neuroscienceopenDocumentation, web resources, and API references are available online.
Last verified 2026-04-30Open record

Annotated Behaviour and Observability Dataset (ABODe)

ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.

abode-home-cage
behavioral-neuroscienceopenThe DataShare record exposes download links for annotations, documentation, license text, and the zipped per-snippet data directory.
Last verified 2026-04-30Open record

DANDI Archive for NWB datasets

DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.

dandi-nwb
electrophysiologyopenPublished Dandiset metadata and archive endpoints are available through the production DANDI API.
Last verified 2026-04-30Open record

International Brain Laboratory public data

The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.

ibl
behavioral-neuroscienceopenPublic sessions can be searched and loaded from the IBL public data server through ONE.
Last verified 2026-04-29Open record

OpenNeuro

OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.

openneuro
neuroscienceopenPublished datasets are available on demand over the internet.
Last verified 2026-04-29Open record