Find research datasets worth reusing
Search datasets from major research repositories and use ShareScore to quickly assess how well each record supports discovery, access, and reuse.
60
datasets available to search
ShareScore release 0.9.0
Dataset results
60 results for “12S”
Figure 2. A, Tree resulting from maximum likelihood analysis from the 12S in A molecular perspective on the evolutionary affinities of an enigmatic neotropical frog, Allophryne ruthveni
Figure 2. A, Tree resulting from maximum likelihood analysis from the 12S data set using the Hasegawa–Kishino–Yano two parameter model (Hasegawa et al., 1985). Included for comparative purposes are bootstrap support from NJ analyses. Below each resolved branch are indicated percentage bootstrap support in excess of 50% for: ML (100 pseudoreplicates), NJ (1000 pseudoreplicates; Kimura 2-parameter), NJ (1000 pseudoreplicates; Tamura–Nei). B, Strict consensus of three most parsimonious trees (all substitutions weighted equally; tree length = 164 steps). Below each branch are indicated percentage bootstrap support (1000 pseudreplicates) in excess of 50% for: MP (unweighted), MP (stems weighted twice loops), MP (transversions weighted four times transitions). Bremer decay indices (DI) are the final value shown below each resolved branch (for MP unweighted only). A dash indicates bootstrap support of less than 50%.
Figure 2 in Mitochondrial 12S rRNA sequences support the existence of a third species of freshwater blackfish (Percicthyidae: Gadopsis) from south-eastern Australia
Figure 2. Phylogenetic trees, using the PAUP software package (Swofford, 1998). A, Maximum parsimony, using a full exhaustive search with 1000 bootstrap replicates. B, Distance analysis, using the neighbour-joining option, bootstrap replicates set at 1000. C, Maximum likelihood, using the Tamura-Nei model with 100 bootstrap replicates.
rCRUX Generated MiFish Universal 12S Expanded +FishCARD Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022 and supplemented with the FishCARD sequences from https://doi.org/10.5281/zenodo.4315277 .</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p> <p> </p>
rCRUX Generated MiFish Universal 12S Expanded Reference Database
<p>rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022.</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
rCRUX Generated MiFish Universal 12S Reference Database
<p>rCRUX generated reference database using NCBI nt blast database downloaded in December 2022.</p> <p>Primer Name: MiFish Universal<br> Gene: 12S<br> Length of Target: 163–185<br> get_seeds_local() minimum length: 170<br> get_seeds_local() maximum length: 250<br> blast_seeds() minimum length: 140<br> blast_seeds() maximum length: 250<br> max_to_blast: 1000<br> Forward Sequence (5'-3'): GTGTCGGTAAAACTCGTGCCAGC<br> Reverse Sequence (5'-3'): CATAGTGGGGTATCTAATCCCAGTTTG<br> Reference: Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a></p> <p>We chose default rCRUX parameters for <em>get_blast_seeds</em>() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for <em>blast_seeds</em>() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'. </p>
Raw data NGS 12s
<p>Raw data from NGS sequencing targeting the 12S marker. The data were used in a study comparing the effectiveness of conventional methods (electrofishing) with an environmental DNA metabarcoding method, for studying the specific richness of fish communities in estuaries on Reunion Island (JANNEL et al. 2024).</p>
Processed 12S fish eDNA sequences
<p>This dataset contains fish eDNA sequences from the 12S mitochondrial gene. eDNA has been collected in 100 stations, 25 sites, in 5 tropical marine regions. Data collection was performed between 2017 and 2020.</p> <p>Raw sequences have been processed through a bioinformatic pipeline, merged, demultiplexed, dereplicated, clustered as OTUs (operational taxonomic units) and assigned to a taxa.</p> <p>The codes to analyse the data can be found at : <a href="https://github.com/virginiemarques/Global_eDNA">https://github.com/virginiemarques/Global_eDNA</a>.</p> <p>The data are used to study the patterns of tropical fish distributions across spatial scales, using two different methodologies, eDNA and visual census.</p>
Processed 12S fish eDNA sequences
Open the record for dataset details and reuse information.
Bony fish 12S rRNA sequencing data from coastal water samples in gulf of Maine
Open the record for dataset details and reuse information.
Raw reads and metadata for 16S and 12S sequencing for microbiome and dietary analysis of Tasmanian devils
Open the record for dataset details and reuse information.
FIGURE 5. 12S in A systematic revision of Draculoides (Schizomida: Hubbardiidae) of the Pilbara, Western Australia, Part I: the Western Pilbara
FIGURE 5. 12S mini-barcodes for all Draculoides species including the operational taxonomic units used in Abrams et al. (2019). This barcode is the maximally diagnostic 50 bp fragment of DNA. Genetic variation within species is shown using IUPAC Ambiguity Codes. See Methods for details. The position of the mini-barcode is reported relative to a specimen of Draculoides celatus (WAM T98698, GenBank number MG913012). The blue tree on the left groups minibarcodes which are most similar to each other but does not represent an accurate phylogeny. The coloured bases in the figure are those that differ from the consensus reference sequence.
FIGURE 1. Maximum likelihood phylogram derived from a Bayesian backbone constraint consensus tree constructed using only taxa for which 12S, 16S, cytochrome b and cytochrome oxidase I in A new species of Dendrobates (Anura: Dendrobatidae) from the Amazonian lowlands in Perú
FIGURE 1. Maximum likelihood phylogram derived from a Bayesian backbone constraint consensus tree constructed using only taxa for which 12S, 16S, cytochrome b and cytochrome oxidase I sequence data were available. Numbers indicate posterior probabilities from the Bayesian analysis. Species of the Ventrimaculatus group are denoted with s.s. (sensu stricto), s.l. (sensu lato) and sp. aff (species affinis).
FIGURE 2. Phylogenetic hypothesis derived from 12S and 16S in A new species of big-headed, fanged dicroglossine frog (Genus Limnonectes) from Thailand
FIGURE 2. Phylogenetic hypothesis derived from 12S and 16S mitochondrial data. Occidozyga laevis and Fejervarya limnocharis were used as outgroups, but are not shown. * indicates clades supported by Bayesian posterior probabilities> 90%, and bootstrap values> 70% from ML (100 replicates) and Parsimony analysis (2000 replicates).
FIGURE 1. Locus specific phylogenies for COI, 12S in Molecular and morphological evaluation of the aphid genus Hyalopterus Koch (Insecta: Hemiptera: Aphididae), with a description of a new species
FIGURE 1. Locus specific phylogenies for COI, 12S, EF-1α, and Buchnera 16S. All trees are from analyses performed with MRBAYES, with node support given as posterior probabilities. Collection data for each specimen are provided in Table 1 and models of sequence evolution used for each gene are provided in Table 2.
FIGURE 1. Bayesian phylogenetic tree obtained with the COI, 12S, 16S in Lost and found: The Eocene family Pyramimitridae (Neogastropoda) discovered in the Recent fauna of the Indo-Pacific
FIGURE 1. Bayesian phylogenetic tree obtained with the COI, 12S, 16S, and 28S genes. Posterior probabilities are shown at nodes.
Figure 2. Geographic distribution and haplotype networks for 12S in Effects of Quaternary climatic oscillations over the Chacoan fauna: phylogeographic patterns in the southern three-banded armadillo Tolypeutes matacus (Cingulata: Chlamyphoridae)
Figure 2. Geographic distribution and haplotype networks for 12S (top panels) and control region (bottom panels). The panels on the left plot the geographical distribution and frequency of haplotypes in the different localities analysed. Localities were labelled according to their ID (see Table 1). The right panels show the haplotype networks, where the dashes on the lines represent mutations, and the black circles represent intermediate variants not found. Principal Chacoan rivers are shown in light-blue labels. Capitalized labels indicate names of Argentinean provinces, and labels with all letters in uppercase refer to neighbouring countries.
FIGURE 3. Cladogram using Bayesian inference with concatenated data from Cytochrome b, 12S in A review of the relationships of Xenochrophis cerasogaster Cantor, 1839 (Serpentes: Colubridae) to its congeners
FIGURE 3. Cladogram using Bayesian inference with concatenated data from Cytochrome b, 12S rRNA, and ND4 gene sequences with Coelognathus radiatus as the out-group. (Red: specimens from Northern Assam, Blue: Specimen from Southern Assam, Green: Specimen from Hyderabad)
FIGURE 2. Cladogram using Maximum likelihood with concatenated data from Cytochrome b, 12S in A review of the relationships of Xenochrophis cerasogaster Cantor, 1839 (Serpentes: Colubridae) to its congeners
FIGURE 2. Cladogram using Maximum likelihood with concatenated data from Cytochrome b, 12S rRNA, and ND4 gene sequences with Coelognathus radiatus as the out-group (Red: specimens from Northern Assam, Blue: Specimen from Southern Assam, Green: Specimen from Hyderabad)
FIGURE 1 in A mitochondrial 12S and 16S rRNA phylogeny of critical genera of Phoridae (Diptera) and related families of Aschiza
FIGURE 1. Maximum likelihood tree derived from analysis of concatenated dipteran 12S and 16S mitochondrial DNA sequences (ln likelihood = 5910.51681, proportion of invariable sites 0.291, gamma shape parameter = 0.480). Taxa as in Table 1. The Hilara maura sequence was assigned as outgroup. The names of suborders, series, families, subfamilies and tribes are also indicated where they are relevant to the discussion in the text. Numbers refer to Bayesian posterior probabilities as percent (top) or percent support in a nonparametric bootstrap analysis by neighborjoining of maximum likelihood distances (bottom). Where only one number occurs it refers to a Bayesian posterior probability: that branch received less than 50% support in the nonparametric bootstrap analysis. Support values for the branch leading to the Phoridae are in bold.
Figure 10. Pairwise 12S in Molecular-genetic-based contribution to the taxonomy of the Acanthocyclops robustus group
Figure 10. Pairwise 12S rRNA sequence divergence within the americanus–robustus–vernalis complex. Genetic distance (Kimura 2-parameter) is compared between and within the four clades depicted in the tree of Figure 9. Note: Columns indicate mean values and bars indicate range (min.–max.).
ScienceDex guides
Understand access before you commit
These curated guides explain access requirements, typical timelines, costs, and reuse considerations for widely used research datasets.
Allen Brain Atlas
Allen Brain Atlas is an Allen Institute collection of brain map atlases, datasets, APIs, and analysis tools covering mouse, human, and non-human primate brain resources.
Annotated Behaviour and Observability Dataset (ABODe)
ABODe is a University of Edinburgh DataShare dataset for behavior classification in group-housed mice using home-cage video, identities, bounding boxes, ground-plate positions, and annotator labels.
DANDI Archive for NWB datasets
DANDI is a BRAIN Initiative archive for publishing and sharing neurophysiology data, including electrophysiology, optophysiology, and behavioral data packaged as NWB and related standards.
International Brain Laboratory public data
The International Brain Laboratory public data releases expose standardized mouse decision-making experiments, including Neuropixels recordings, widefield calcium imaging, behavior, and session metadata accessed through the ONE API.
OpenNeuro
OpenNeuro is a free, open platform for sharing neuroimaging datasets, with public search, dataset pages, and download paths for web, S3, DataLad, and the OpenNeuro CLI.