Find research datasets worth reusing

rCRUX Generated Cephalpod 18S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Ceph18S Gene:   18S Length of Target:    150–190 get_seeds_local() minimum length:    105 get_seeds_local() maximum length:    235 blast_seeds() minimum length:    65 blast_seeds() maximum length:    195 max_to_blast:  100 Forward Sequence (5'-3'):   CGCGGCGCTACATATTAGAC Reverse Sequence (5'-3'):    GCACTTAACCGACCGTCGAC Reference:    D. S. W. de Jonge, V. Merten, T. Bayer, O. Puebla, T. B. H. Reusch, H.-J. T. Hoving, A novel metabarcoding primer pair for environmental DNA analysis of Cephalopoda (Mollusca) targeting the nuclear 18S rRNA region. R. Soc. Open Sci. 8, 201388 (2021) <a href="https://doi.org/10.1098/rsos.201388">https://doi.org/10.1098/rsos.201388</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated MiFish Universal 12S Expanded Reference Database

rCRUX generated reference database using NCBI nt blast database and an additional custom blast database comprised of all Actinopterygii mitogenomes. Both blast databases were downloaded in December 2022. Primer Name:  MiFish Universal Gene:   12S Length of Target:    163–185 get_seeds_local() minimum length:    170 get_seeds_local() maximum length:    250 blast_seeds() minimum length:    140 blast_seeds() maximum length:    250 max_to_blast:  1000 Forward Sequence (5'-3'):   GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'):    CATAGTGGGGTATCTAATCCCAGTTTG Reference:    Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Fungal ITS Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Fungal_ITS gITS7/ITS4 Gene:   FITS Length of Target:    150-330 get_seeds_local() minimum length:    105 get_seeds_local() maximum length:    500 blast_seeds() minimum length:    65 blast_seeds() maximum length:    461 max_to_blast:  100 Forward Sequence (5'-3'):   GTGARTCATCGARTCTTTG Reverse Sequence (5'-3'):    TCCTCCGCTTATTGATATGC Reference:    White, T. J., Bruns, T., Lee, S., & Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, 18(1), 315–322. Ihrmark, K., Bödeker, I., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., Strid, Y., Stenlid, J., Brandström-Durling, M., & Clemmensen, K. E. (2012). New primers to amplify the fungal ITS2 region–evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiology Ecology, 82(3), 666–677. https://doi.org/10.1111/j.1574-6941.2012.01437.x We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Ford Fish 16S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Ford Fish 16S Gene:   16S Length of Target:    330 get_seeds_local() minimum length:    279 get_seeds_local() maximum length:    477 blast_seeds() minimum length:    231 blast_seeds() maximum length:    429 max_to_blast:  1000 Forward Sequence (5'-3'):   GCAATCACTTGTCTTTTAAATGAAGACC, GTAATCACTTGTCTTTTAAATGAAGACC Reverse Sequence (5'-3'):    GGATTGCGCTGTTATCCCTA Reference:    Ford MJ, Hempelmann J, Hanson MB, Ayres KL, Baird RW, et al. (2016) Estimation of a Killer Whale (Orcinus orca) Population’s Diet Using Sequencing Analysis of DNA from Feces. PLOS ONE 11(1): e0144956. https://doi.org/10.1371/journal.pone.0144956 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated ITS2 Plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  ITS2 Plants Gene:   ITS2 Length of Target:    450-550 get_seeds_local() minimum length:    315 get_seeds_local() maximum length:    600 blast_seeds() minimum length:    270 blast_seeds() maximum length:    560 max_to_blast:  100 Forward Sequence (5'-3'):   ATGCGATACTTGGTGTGAAT Reverse Sequence (5'-3'):    GACGCTTCTCCAGACTACAAT Reference:    Gu, W., Song, J., Cao, Y., Sun, Q., Yao, H., Wu, Q., ... & Duan, J. (2013). Application of the ITS2 region for barcoding medicinal plants of Selaginellaceae in Pteridophyta. PloS one, 8(6), e67818. <a href="https://doi.org/10.1371/journal.pone.0067818">https://doi.org/10.1371/journal.pone.0067818</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Kelly Metazoan 16S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Kelly Metazoan 16S Gene:   16S Length of Target:    114-160 get_seeds_local() minimum length:    80 get_seeds_local() maximum length:    195 blast_seeds() minimum length:    50 blast_seeds() maximum length:    168 max_to_blast:  100 Forward Sequence (5'-3'):   AGTTACYYTAGGGATAACAGCG Reverse Sequence (5'-3'):    CCGGTCTGAACTCAGATCAYGT Reference:    Kelly, R. P., O’Donnell, J. L., Lowell, N. C., Shelton, A. O., Samhouri, J. F., Hennessey, S. M., ... & Williams, G. D. (2016). Genetic signatures of ecological diversity along an urbanization gradient. PeerJ, 4, e2444. https://doi.org/10.7717/peerj.2444 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated MiDeca Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  MiDeca Gene:   16S Length of Target:    154-184 get_seeds_local() minimum length:    105 get_seeds_local() maximum length:    230 blast_seeds() minimum length:    66 blast_seeds() maximum length:    191 max_to_blast:  50 Forward Sequence (5'-3'):   GGACGATAAGACCCTATAAA Reverse Sequence (5'-3'):    ACGCTGTTATCCCTAAAGT Reference:   Komai, T., Gotoh, R.O., Sado, T. and Miya, M., 2019. Development of a new set of PCR primers for eDNA metabarcoding decapod crustaceans. Metabarcoding and Metagenomics, 3, p.e33835. https://doi.org/10.3897/mbmg.6.76534 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated MarVer3 Marine Mammal Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  MarVer3 Marine Mammal Gene:   16S Length of Target:    232-274 get_seeds_local() minimum length:    160 get_seeds_local() maximum length:    345 blast_seeds() minimum length:    124 blast_seeds() maximum length:    309 max_to_blast:  100 Forward Sequence (5'-3'):   AGACGAGAAGACCCTRTG Reverse Sequence (5'-3'):    GGATTGCGCTGTTATCCC Reference:    Valsecchi, E., Bylemans, J., Goodman, S. J., Lombardi, R., Carr, I., Castellano, L., ... & Galli, P. (2020). Novel universal primers for metabarcoding environmental DNA surveys of marine mammals and other marine vertebrates. Environmental DNA, 2(4), 460-476. https://doi.org/10.1002/edn3.72 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated 18s SSU3/SSU4 Metazoan Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  18s SSU3/SSU4 Metazoan Gene:   18S v7 Length of Target:    170 get_seeds_local() minimum length:    120 get_seeds_local() maximum length:    220 blast_seeds() minimum length:    98 blast_seeds() maximum length:    200 max_to_blast:  100 Forward Sequence (5'-3'):   GGTCTGTGATGCCCTTAGATG Reverse Sequence (5'-3'):    GGTGTGTACAAAGGGCAGGG Reference:   McInnes, J. C., Alderman, R., Deagle, B. E., Lea, M. A., Raymond, B., & Jarman, S. N. (2017). Optimised scat collection protocols for dietary DNA metabarcoding in vertebrates. Methods in Ecology and Evolution, 8(2), 192-202. http://dx.doi.org/10.1111/2041-210X.12677 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated MiFish Universal 12S Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  MiFish Universal Gene:   12S Length of Target:    163–185 get_seeds_local() minimum length:    170 get_seeds_local() maximum length:    250 blast_seeds() minimum length:    140 blast_seeds() maximum length:    250 max_to_blast:  1000 Forward Sequence (5'-3'):   GTGTCGGTAAAACTCGTGCCAGC Reverse Sequence (5'-3'):    CATAGTGGGGTATCTAATCCCAGTTTG Reference:    Miya, M., Sato, Y., Fukunaga, T., Sado, T., Poulsen, J. Y., Sato, K., ... & Kondoh, M. (2015). MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. Royal Society open science, 2(7), 150088. <a href="https://doi.org/10.1098/rsos.150088">https://doi.org/10.1098/rsos.150088</a> We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Baker Dlp1.5-H/Oordlp4 Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Scott Baker Dlp1.5-H/Oordlp4 Gene:   D loop Length of Target:    350-390 get_seeds_local() minimum length:    245 get_seeds_local() maximum length:    495 blast_seeds() minimum length:    205 blast_seeds() maximum length:    455 max_to_blast:  100 Forward Sequence (5'-3'):   TCACCCAAAGCTGRARTTCTA Reverse Sequence (5'-3'):    GCGGGTTGCTGGTTTCACG Reference:   Baker, C. S., Steel, D., Nieukirk, S., & Klinck, H. (2018). Environmental DNA (eDNA) from the wake of the whales: Droplet digital PCR for detection and species identification. Frontiers in Marine Science, 5, 133. https://doi.org/10.3389/fmars.2018.00133 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated MiSebastes Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  MiSebastes Gene:   CytB Length of Target:    153 get_seeds_local() minimum length:    107 get_seeds_local() maximum length:    199 blast_seeds() minimum length:    71 blast_seeds() maximum length:    163 max_to_blast:  100 Forward Sequence (5'-3'):   AAGCTCATTCAAGTGCTT Reverse Sequence (5'-3'):    GACCACTTACACAATTCT Reference:   Min, M. A., Barber, P. H., & Gold, Z. (2021). MiSebastes: An eDNA metabarcoding primer set for rockfishes (genus Sebastes). Conservation Genetics Resources, 13(4), 447-456. https://doi.org/10.1007/s12686-021-01219-2 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Taberlet c/h trnl Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  Taberlet c/h trnl Gene:   trnl Length of Target:    150 get_seeds_local() minimum length:    105 get_seeds_local() maximum length:    150 blast_seeds() minimum length:    85 blast_seeds() maximum length:    128 max_to_blast:  100 Forward Sequence (5'-3'):   CGAAATCGGTAGACGCTACG Reverse Sequence (5'-3'):    CCATTGAGTCTCTGCACCTATC Reference:   Taberlet, P., Gielly, L., Pautou, G., & Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of. Plant molecular biology, 17, 1105-1109. & Taberlet, Pierre, Eric Coissac, François Pompanon, Ludovic Gielly, Christian Miquel, Alice Valentini, Thierry Vermat, Gerard Corthier, Christian Brochmann, and Eske Willerslev. "Power and limitations of the chloroplast trn L (UAA) intron for plant DNA barcoding." Nucleic acids research 35, no. 3 (2007): e14-e14. We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated Teleo Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  teleo L1848/H1913 Gene:   12S Length of Target:    100 get_seeds_local() minimum length:    70 get_seeds_local() maximum length:    130 blast_seeds() minimum length:    40 blast_seeds() maximum length:    100 max_to_blast:  100 Forward Sequence (5'-3'):   ACACCGCCCGTCACTCT Reverse Sequence (5'-3'):    CTTCCGGTACACTTACCATG Reference:   Valentini, A., Taberlet, P., Miaud, C., Civade, R., Herder, J., Thomsen, P. F., ... & Gaboriaud, C. (2016). Next‐generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology, 25(4), 929-942. https://doi.org/10.1111/mec.13428 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

rCRUX Generated trnl plants Reference Database

rCRUX generated reference database using NCBI nt blast database downloaded in December 2022. Primer Name:  trnl plants Gene:   trnl Length of Target:    ~85 get_seeds_local() minimum length:    60 get_seeds_local() maximum length:    110 blast_seeds() minimum length:    23 blast_seeds() maximum length:    73 max_to_blast:  250 Forward Sequence (5'-3'):   GGGCAATCCTGAGCCAA Reverse Sequence (5'-3'):    TTTGAGTCTCTGCACCTATC Reference:   Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., ... & Willerslev, E. (2007). Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Research 3 (35),.(2007). https://doi.org/10.1093%2Fnar%2Fgkl938 We chose default rCRUX parameters for get_blast_seeds() of percent coverage of 70, percent identity of 70, evalue 3e+7, and max number of blast alignments = '100000000' and for blast_seeds() of coverage of 70, percent identity of 70, evalue 3e+7, rank of genus, and max number of blast alignments = '10000000'.

Fig. 45. Character 66. Uncal length, states 0 and 1 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna

Fig. 45. Character 66. Uncal length, states 0 and 1: (0) of moderate proportions, retractable within pygofer; (1) exceedingly long, non-retractable within pygofer.

Fig. 38. Character 50 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna

Fig. 38. Character 50. Pygofer in lateral view showing distal shoulder, states 0–2: (0) not developed; (1) broad, rounded, often the most distal part of pygofer; (2) distally extended into pointed, and often apically up-turned, lobe.

Fig. 42. Character 63 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna

Fig. 42. Character 63. Uncal shape, lateral view, states 0–2: (0) n-shaped in cross-section, apically with sides meeting but not fused; (1) digitate or basically tubular, large, dominant; (2) duck-bill shaped, small and flat, not dominant; (3) absent.

Fig. 41. Character 58 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna

Fig. 41. Character 58. Pygofer basal lobe development, lateral view, states 0–3: (0) moderately developed, tending to be broadly rounded in lateral view; (1) ill-defined, substantially confluent with pygofer margin; (2) large, in lateral view projecting outwards, basically triangular but sometimes distally elongate; (3) large, in lateral view projecting outwards, linear, parallel-sided.

Fig. 39. Character 51 in An Appraisal of the Higher Classification of Cicadas (Hemiptera: Cicadoidea) with Special Reference to the Australian Fauna

Fig. 39. Character 51. Pygofer in ventral view showing inner tooth, states 0–1: (0) absent; (1) present.